Incidental Mutation 'R3885:Vmn2r97'
ID308732
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18928334 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 164 (L164F)
Ref Sequence ENSEMBL: ENSMUSP00000129313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168710
AA Change: L164F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: L164F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000232219
AA Change: L164F

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232325
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGAGATCAATGGGAACCCC -3'
(R):5'- GAACTTACCTGGCTTCATTTACTGC -3'

Sequencing Primer
(F):5'- CCAACATATCTCTTGGGTTTGATTTC -3'
(R):5'- CCTGGATTGAACTCTATGTTC -3'
Posted On2015-04-17