Incidental Mutation 'R3883:Ngly1'
ID 308838
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene Name N-glycanase 1
Synonyms PNGase, 1110002C09Rik, Png1
MMRRC Submission 040796-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.903) question?
Stock # R3883 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 6157837-6220449 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16270574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 195 (I195V)
Ref Sequence ENSEMBL: ENSMUSP00000022310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000223973] [ENSMUST00000224154] [ENSMUST00000224656]
AlphaFold Q9JI78
PDB Structure Solution structure of the N-terminal portion of the PUB domain of mouse peptide:N-glycanase [SOLUTION NMR]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Crystal structure of intein-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of His-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of the PUB domain of mouse PNGase [X-RAY DIFFRACTION]
Crystal structure of the mouse p97/PNGase complex [X-RAY DIFFRACTION]
Crystal structure of mouse Peptide N-Glycanase C-terminal domain in complex with mannopentaose [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022310
AA Change: I195V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: I195V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223879
Predicted Effect possibly damaging
Transcript: ENSMUST00000223973
AA Change: I94V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224044
Predicted Effect probably benign
Transcript: ENSMUST00000224154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224181
Predicted Effect possibly damaging
Transcript: ENSMUST00000224656
AA Change: I195V

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226089
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,980,228 (GRCm39) S423L probably benign Het
Ankmy1 T G 1: 92,813,874 (GRCm39) E435A probably damaging Het
Ano5 T A 7: 51,216,052 (GRCm39) M343K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
C3 T C 17: 57,524,173 (GRCm39) probably null Het
Cdk17 T C 10: 93,047,939 (GRCm39) probably null Het
Cntn2 A G 1: 132,456,677 (GRCm39) V123A probably damaging Het
Cracd T A 5: 77,004,421 (GRCm39) W261R unknown Het
Dchs1 A G 7: 105,411,770 (GRCm39) Y1449H probably damaging Het
Ddx42 T A 11: 106,138,518 (GRCm39) N772K probably benign Het
Dnah11 T C 12: 117,942,188 (GRCm39) probably benign Het
Edn1 T A 13: 42,455,382 (GRCm39) F4L probably benign Het
Epb41l3 C T 17: 69,581,111 (GRCm39) R552* probably null Het
Epc1 T C 18: 6,452,258 (GRCm39) D267G possibly damaging Het
Fbxo22 A T 9: 55,130,546 (GRCm39) T169S probably benign Het
Fmnl1 A G 11: 103,072,940 (GRCm39) N144D probably damaging Het
Folh1 A G 7: 86,424,864 (GRCm39) L35P possibly damaging Het
Gm10220 A C 5: 26,321,908 (GRCm39) S255A possibly damaging Het
Gm15446 G T 5: 110,088,313 (GRCm39) V9L probably damaging Het
Hipk2 A G 6: 38,676,200 (GRCm39) L1011P probably damaging Het
Kif4-ps G T 12: 101,112,473 (GRCm39) V201L probably damaging Het
Klk1b16 T C 7: 43,788,887 (GRCm39) V40A possibly damaging Het
Lgsn C A 1: 31,215,540 (GRCm39) D3E probably benign Het
Mavs T C 2: 131,087,218 (GRCm39) S239P probably benign Het
Mrtfb T A 16: 13,219,322 (GRCm39) V667D probably damaging Het
Mtrf1 A G 14: 79,656,707 (GRCm39) Y403C probably damaging Het
Mycbp2 A C 14: 103,532,686 (GRCm39) L390V probably damaging Het
Neto2 A G 8: 86,389,894 (GRCm39) S190P probably damaging Het
Or10d4c A G 9: 39,558,420 (GRCm39) I133V probably benign Het
Or13p5 T C 4: 118,591,882 (GRCm39) I52T probably benign Het
Pde4dip T C 3: 97,620,504 (GRCm39) K1632E probably damaging Het
Pigk T C 3: 152,419,832 (GRCm39) S21P probably benign Het
Rabggtb A G 3: 153,616,417 (GRCm39) F82L probably damaging Het
Reep6 G A 10: 80,171,369 (GRCm39) R415Q probably benign Het
Serpinb13 T C 1: 106,926,302 (GRCm39) V159A probably benign Het
Slc5a8 T A 10: 88,738,325 (GRCm39) M196K possibly damaging Het
Sprr1a G A 3: 92,391,827 (GRCm39) P58L probably damaging Het
Taf1a A T 1: 183,172,288 (GRCm39) T10S possibly damaging Het
Tap1 T A 17: 34,412,232 (GRCm39) V479E probably damaging Het
Trpm4 C T 7: 44,971,422 (GRCm39) probably null Het
Ush2a T C 1: 187,995,579 (GRCm39) Y117H probably benign Het
Vmn2r58 A T 7: 41,513,914 (GRCm39) L243* probably null Het
Zbtb32 A G 7: 30,290,569 (GRCm39) I242T probably benign Het
Zbtb7a T C 10: 80,983,859 (GRCm39) C434R probably damaging Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16,290,873 (GRCm38) missense probably benign 0.14
IGL02199:Ngly1 APN 14 16,290,844 (GRCm38) missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16,281,791 (GRCm38) missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16,290,939 (GRCm38) intron probably benign
IGL03209:Ngly1 APN 14 16,281,831 (GRCm38) nonsense probably null
IGL03290:Ngly1 APN 14 16,281,866 (GRCm38) missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16,260,636 (GRCm38) missense probably benign
R0518:Ngly1 UTSW 14 16,290,774 (GRCm38) nonsense probably null
R0521:Ngly1 UTSW 14 16,290,774 (GRCm38) nonsense probably null
R1612:Ngly1 UTSW 14 16,290,867 (GRCm38) nonsense probably null
R1851:Ngly1 UTSW 14 16,260,585 (GRCm38) missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16,277,877 (GRCm38) missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16,290,721 (GRCm38) splice site probably null
R2696:Ngly1 UTSW 14 16,283,439 (GRCm38) missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16,290,766 (GRCm38) intron probably benign
R4700:Ngly1 UTSW 14 16,281,809 (GRCm38) missense probably benign 0.01
R5160:Ngly1 UTSW 14 16,281,751 (GRCm38) missense probably damaging 0.98
R5555:Ngly1 UTSW 14 16,270,508 (GRCm38) nonsense probably null
R5603:Ngly1 UTSW 14 16,260,762 (GRCm38) missense probably benign 0.01
R5764:Ngly1 UTSW 14 16,260,799 (GRCm38) missense probably benign
R5980:Ngly1 UTSW 14 16,270,509 (GRCm38) missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16,294,634 (GRCm38) missense probably benign 0.01
R6887:Ngly1 UTSW 14 16,281,836 (GRCm38) missense probably benign 0.02
R6943:Ngly1 UTSW 14 16,283,467 (GRCm38) missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16,283,445 (GRCm38) missense probably damaging 1.00
R7447:Ngly1 UTSW 14 16,290,844 (GRCm38) missense probably damaging 1.00
R7748:Ngly1 UTSW 14 16,290,820 (GRCm38) missense possibly damaging 0.62
R8123:Ngly1 UTSW 14 16,260,799 (GRCm38) missense probably benign
R8482:Ngly1 UTSW 14 16,310,377 (GRCm38) missense probably benign 0.00
R8854:Ngly1 UTSW 14 16,281,769 (GRCm38) missense probably damaging 1.00
R9094:Ngly1 UTSW 14 16,280,721 (GRCm38) missense probably damaging 1.00
R9349:Ngly1 UTSW 14 16,281,801 (GRCm38) nonsense probably null
X0053:Ngly1 UTSW 14 16,254,743 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGATCTTAGTATTGTAAAGGTATCCA -3'
(R):5'- TCCACATAGGTGTAGGTAATGTATT -3'

Sequencing Primer
(F):5'- TCTTAATGAAATCTGAGAACCACAGC -3'
(R):5'- TTATAGTGTGCACATATAGCCAAAGG -3'
Posted On 2015-04-17