Incidental Mutation 'R3883:Mtrf1'
ID308839
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Namemitochondrial translational release factor 1
Synonyms
MMRRC Submission 040796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3883 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location79397772-79423587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79419267 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 403 (Y403C)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
Predicted Effect probably damaging
Transcript: ENSMUST00000022600
AA Change: Y403C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: Y403C

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227610
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm10220 A C 5: 26,116,910 S255A possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Olfr961 A G 9: 39,647,124 I133V probably benign Het
Pde4dip T C 3: 97,713,188 K1632E probably damaging Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Tap1 T A 17: 34,193,258 V479E probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79423425 missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79402920 splice site probably benign
IGL01866:Mtrf1 APN 14 79401508 missense probably benign
IGL02290:Mtrf1 APN 14 79401811 nonsense probably null
IGL02929:Mtrf1 APN 14 79402833 missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79415980 missense possibly damaging 0.80
IGL03342:Mtrf1 APN 14 79415871 splice site probably benign
IGL03342:Mtrf1 APN 14 79415872 splice site probably null
R0212:Mtrf1 UTSW 14 79419279 missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79406850 missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79415887 missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79419268 nonsense probably null
R0981:Mtrf1 UTSW 14 79401590 missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79401833 missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79401671 missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79413080 missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79411650 missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79401688 missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79406587 missense probably benign
R5616:Mtrf1 UTSW 14 79401445 missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79402891 missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79413081 missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79423491 frame shift probably null
R7182:Mtrf1 UTSW 14 79423464 missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79423491 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGATATTTAATCCCCTCAAGCAGG -3'
(R):5'- CCTGCAGCAACATTTAGGGC -3'

Sequencing Primer
(F):5'- CTCAAGCAGGAAAATCAAGTATAA -3'
(R):5'- GCTAAGAGCAGCTTCTACCTG -3'
Posted On2015-04-17