Incidental Mutation 'R3899:Ccdc33'
ID308875
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3899 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58032917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000112613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: D525G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: D525G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: D710G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: D710G

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: D524G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: D524G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153106
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: D710G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Crim1 C A 17: 78,281,354 T286N probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Stk32b A G 5: 37,457,154 S337P probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Vmn2r97 T C 17: 18,947,611 I709T probably damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 intron probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGATAGGCTTCCCCTGTG -3'
(R):5'- TCAGCAGAATCCCACGTGTG -3'

Sequencing Primer
(F):5'- GGTATTGGTTCCTTCCTCTCACAGAG -3'
(R):5'- AGAATCCCACGTGTGCCCTC -3'
Posted On2015-04-17