Incidental Mutation 'R3899:Vmn2r97'
ID308903
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3899 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18947611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 709 (I709T)
Ref Sequence ENSEMBL: ENSMUSP00000129313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect probably damaging
Transcript: ENSMUST00000168710
AA Change: I709T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: I709T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Ccdc33 T C 9: 58,032,917 D524G probably damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Crim1 C A 17: 78,281,354 T286N probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Stk32b A G 5: 37,457,154 S337P probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCAAATAATCGAGCTCTGAG -3'
(R):5'- TAGCATAACTCCCAAGGGCC -3'

Sequencing Primer
(F):5'- GTTCTTTGAACTTCATTGGTAAGCC -3'
(R):5'- GGCCATCAAGCAGAGGTATCC -3'
Posted On2015-04-17