Incidental Mutation 'R3901:Pou2f1'
ID308963
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 165894969 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 349 (P349R)
Ref Sequence ENSEMBL: ENSMUSP00000125371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000184643]
Predicted Effect unknown
Transcript: ENSMUST00000027850
AA Change: P402R
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: P402R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000069609
AA Change: P454R
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: P454R

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082225
SMART Domains Protein: ENSMUSP00000080856
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
POU 233 309 4.88e-27 SMART
low complexity region 310 326 N/A INTRINSIC
HOX 336 398 2.54e-19 SMART
low complexity region 416 442 N/A INTRINSIC
low complexity region 447 514 N/A INTRINSIC
low complexity region 523 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111426
AA Change: P454R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: P454R

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111427
AA Change: P454R
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: P454R

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111429
AA Change: P442R
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: P442R

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159212
AA Change: P349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565
AA Change: P349R

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160260
AA Change: P465R
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: P465R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160908
AA Change: P465R
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: P465R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176004
SMART Domains Protein: ENSMUSP00000135153
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 149 159 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176942
SMART Domains Protein: ENSMUSP00000135052
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 65 94 N/A INTRINSIC
low complexity region 112 154 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
low complexity region 205 226 N/A INTRINSIC
low complexity region 233 251 N/A INTRINSIC
POU 275 349 1.55e-52 SMART
low complexity region 350 366 N/A INTRINSIC
HOX 376 438 2.54e-19 SMART
low complexity region 456 482 N/A INTRINSIC
low complexity region 487 554 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177472
Predicted Effect unknown
Transcript: ENSMUST00000184643
AA Change: P442R
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565
AA Change: P442R

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R4838:Pou2f1 UTSW 1 165916923 missense probably null 1.00
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R5951:Pou2f1 UTSW 1 165883056 unclassified probably benign
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165915115 missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCAGTTCACAATGACAGATTTT -3'
(R):5'- CCAGCATGGCAAATATATAACATGAAA -3'

Sequencing Primer
(F):5'- AGATCTAAATGTGAGCTCGCTGC -3'
(R):5'- CTCGGAAGACATCACCTT -3'
Posted On2015-04-17