Incidental Mutation 'R3901:Kcnj3'
ID308967
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 3
SynonymsGIRK1, Kcnf3, Kir3.1
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location55435970-55598145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55437348 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 50 (N50D)
Ref Sequence ENSEMBL: ENSMUSP00000108251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
Predicted Effect probably benign
Transcript: ENSMUST00000067101
AA Change: N50D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: N50D

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112632
AA Change: N50D

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824
AA Change: N50D

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112633
AA Change: N50D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: N50D

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180810
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55595272 missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55437204 missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55437578 missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55594959 nonsense probably null
R0565:Kcnj3 UTSW 2 55595264 missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55437223 missense possibly damaging 0.69
R1318:Kcnj3 UTSW 2 55437738 missense possibly damaging 0.88
R1592:Kcnj3 UTSW 2 55437886 missense probably damaging 1.00
R1756:Kcnj3 UTSW 2 55437220 missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55437244 missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55437331 missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2893:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R4470:Kcnj3 UTSW 2 55437865 missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55446979 nonsense probably null
R4694:Kcnj3 UTSW 2 55594906 missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55437578 missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55447047 splice site probably null
R5332:Kcnj3 UTSW 2 55437547 missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55437318 missense probably benign 0.10
R6352:Kcnj3 UTSW 2 55437549 missense probably benign 0.06
R7042:Kcnj3 UTSW 2 55594865 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CGTGTTTGAATCTGGCTCGC -3'
(R):5'- TAGACATTGGCCACACAGGG -3'

Sequencing Primer
(F):5'- GAATCTGGCTCGCCCCTC -3'
(R):5'- CACAGGGAGTGTAGTTGCC -3'
Posted On2015-04-17