Incidental Mutation 'R3901:Cpne5'
ID308996
Institutional Source Beutler Lab
Gene Symbol Cpne5
Ensembl Gene ENSMUSG00000024008
Gene Namecopine V
Synonyms
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29156550-29237797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29159108 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 566 (R566C)
Ref Sequence ENSEMBL: ENSMUSP00000024805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024805]
Predicted Effect unknown
Transcript: ENSMUST00000024805
AA Change: R566C
SMART Domains Protein: ENSMUSP00000024805
Gene: ENSMUSG00000024008
AA Change: R566C

DomainStartEndE-ValueType
C2 23 131 2.09e-9 SMART
C2 161 283 1.88e-11 SMART
low complexity region 290 297 N/A INTRINSIC
VWA 326 519 1.52e-13 SMART
low complexity region 564 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126993
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Cpne5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Cpne5 APN 17 29160337 missense probably damaging 1.00
R0329:Cpne5 UTSW 17 29211660 missense probably damaging 1.00
R0330:Cpne5 UTSW 17 29211660 missense probably damaging 1.00
R0462:Cpne5 UTSW 17 29176189 missense probably benign 0.12
R0699:Cpne5 UTSW 17 29209693 missense probably damaging 1.00
R0891:Cpne5 UTSW 17 29202919 splice site probably benign
R1872:Cpne5 UTSW 17 29204693 missense probably benign 0.12
R2167:Cpne5 UTSW 17 29162332 missense probably damaging 1.00
R4037:Cpne5 UTSW 17 29159113 missense unknown
R4478:Cpne5 UTSW 17 29209476 missense probably damaging 0.99
R4588:Cpne5 UTSW 17 29164713 missense probably benign 0.10
R4853:Cpne5 UTSW 17 29161198 missense probably benign 0.01
R5630:Cpne5 UTSW 17 29226216 missense probably damaging 1.00
R5686:Cpne5 UTSW 17 29184017 missense possibly damaging 0.83
R7019:Cpne5 UTSW 17 29226222 missense probably damaging 1.00
R7086:Cpne5 UTSW 17 29159077 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCACAGTCCCCTGGATTTG -3'
(R):5'- ACAGATGAAGGACTCAGCAC -3'

Sequencing Primer
(F):5'- AGGCCCTGACACCCCATTTC -3'
(R):5'- ACTCAGCACAGAGGCATGGC -3'
Posted On2015-04-17