Incidental Mutation 'R3897:Man2b1'
ID 309014
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Name mannosidase 2, alpha B1
Synonyms lysosomal alpha-mannosidase
MMRRC Submission 040808-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3897 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 85809899-85824911 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 85823577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
AlphaFold O09159
Predicted Effect probably benign
Transcript: ENSMUST00000034121
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,254,245 (GRCm39) H184R probably benign Het
Ap1g1 A G 8: 110,581,631 (GRCm39) D633G probably damaging Het
Arhgef28 C T 13: 98,093,084 (GRCm39) R999H probably damaging Het
Armc3 T C 2: 19,273,988 (GRCm39) S341P probably damaging Het
Cmya5 T C 13: 93,233,189 (GRCm39) E633G possibly damaging Het
Colgalt1 G A 8: 72,072,306 (GRCm39) M275I probably damaging Het
Commd7 T C 2: 153,464,710 (GRCm39) T23A probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
Dlgap4 C A 2: 156,587,989 (GRCm39) P89Q probably damaging Het
Ecm1 A G 3: 95,643,298 (GRCm39) L334P probably damaging Het
Fzd8 G A 18: 9,214,939 (GRCm39) V674I possibly damaging Het
Gosr2 A G 11: 103,588,472 (GRCm39) Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 (GRCm39) D283V probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqcm C T 8: 76,480,028 (GRCm39) R329C probably damaging Het
Kdm4b T C 17: 56,703,955 (GRCm39) C233R probably damaging Het
Ltbp1 T C 17: 75,581,011 (GRCm39) C391R probably damaging Het
Mgat4f A G 1: 134,318,176 (GRCm39) D316G possibly damaging Het
Nisch A G 14: 30,912,957 (GRCm39) probably benign Het
Nrxn2 T G 19: 6,569,287 (GRCm39) D1394E probably damaging Het
Or4c12 T C 2: 89,774,153 (GRCm39) E102G probably benign Het
Or4k77 T C 2: 111,199,106 (GRCm39) L43P possibly damaging Het
Pabpc6 T C 17: 9,888,056 (GRCm39) D165G probably benign Het
Psat1 A G 19: 15,896,817 (GRCm39) probably null Het
Psd A C 19: 46,313,024 (GRCm39) N115K possibly damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Rnf144a A G 12: 26,360,712 (GRCm39) V275A probably damaging Het
Slc35b3 A G 13: 39,118,739 (GRCm39) F356L probably benign Het
Tmc4 A G 7: 3,674,087 (GRCm39) V364A probably benign Het
Tmem203 T C 2: 25,145,935 (GRCm39) F85S probably benign Het
Tra2a T C 6: 49,222,476 (GRCm39) probably benign Het
Ttc21b C T 2: 66,065,413 (GRCm39) E454K probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85,811,267 (GRCm39) splice site probably null
IGL00671:Man2b1 APN 8 85,820,567 (GRCm39) missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85,824,059 (GRCm39) missense probably benign 0.00
dateline UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
greenwich UTSW 8 85,812,085 (GRCm39) nonsense probably null
longitude UTSW 8 85,821,773 (GRCm39) nonsense probably null
meridian UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85,824,118 (GRCm39) missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85,819,645 (GRCm39) missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85,823,405 (GRCm39) missense probably benign
R0727:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85,823,458 (GRCm39) missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85,821,800 (GRCm39) missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85,813,474 (GRCm39) missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85,820,563 (GRCm39) missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85,813,451 (GRCm39) missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85,821,964 (GRCm39) missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85,812,013 (GRCm39) missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85,819,653 (GRCm39) splice site probably benign
R3971:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85,817,565 (GRCm39) missense probably benign 0.22
R5183:Man2b1 UTSW 8 85,822,413 (GRCm39) missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85,811,088 (GRCm39) missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85,820,839 (GRCm39) missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85,823,675 (GRCm39) missense probably benign 0.44
R6341:Man2b1 UTSW 8 85,822,028 (GRCm39) missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85,824,076 (GRCm39) missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85,811,108 (GRCm39) missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85,823,482 (GRCm39) missense probably benign 0.01
R6631:Man2b1 UTSW 8 85,813,440 (GRCm39) splice site probably null
R6828:Man2b1 UTSW 8 85,813,548 (GRCm39) missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85,817,700 (GRCm39) splice site probably null
R7159:Man2b1 UTSW 8 85,813,909 (GRCm39) missense probably benign 0.09
R7267:Man2b1 UTSW 8 85,813,804 (GRCm39) missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85,817,594 (GRCm39) nonsense probably null
R7786:Man2b1 UTSW 8 85,812,085 (GRCm39) nonsense probably null
R8022:Man2b1 UTSW 8 85,822,242 (GRCm39) missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85,823,674 (GRCm39) missense probably benign 0.03
R8251:Man2b1 UTSW 8 85,821,758 (GRCm39) missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85,822,907 (GRCm39) missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85,820,772 (GRCm39) missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85,821,782 (GRCm39) missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85,821,773 (GRCm39) nonsense probably null
R8891:Man2b1 UTSW 8 85,811,084 (GRCm39) missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85,818,539 (GRCm39) missense probably benign 0.36
R9059:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
Z1176:Man2b1 UTSW 8 85,820,567 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGTGCATTTGCTCACACTG -3'
(R):5'- CTTGTTGGATGCACTGCTCAC -3'

Sequencing Primer
(F):5'- GGCCAAAGATGCTGCTGCTG -3'
(R):5'- GTTGGATGCACTGCTCACTGTAAAC -3'
Posted On 2015-04-17