Incidental Mutation 'R3897:Ap1g1'
ID309015
Institutional Source Beutler Lab
Gene Symbol Ap1g1
Ensembl Gene ENSMUSG00000031731
Gene Nameadaptor protein complex AP-1, gamma 1 subunit
SynonymsD8Ertd374e, Adtg, gamma-adaptin
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109778554-109864204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109854999 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 633 (D633G)
Ref Sequence ENSEMBL: ENSMUSP00000090844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034171] [ENSMUST00000093157]
Predicted Effect probably damaging
Transcript: ENSMUST00000034171
AA Change: D630G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731
AA Change: D630G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093157
AA Change: D633G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731
AA Change: D633G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173980
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality before implantation. Heterozygotes display slow postnatal weight gain, decreased CD4-positive, alpha beta T cell number in the thymus, and decreased body size up to 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Ap1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ap1g1 APN 8 109832782 missense possibly damaging 0.85
IGL01907:Ap1g1 APN 8 109843343 splice site probably benign
IGL02248:Ap1g1 APN 8 109863433 utr 3 prime probably benign
IGL02548:Ap1g1 APN 8 109849622 missense probably damaging 1.00
Collapse UTSW 8 109828336 critical splice donor site probably null
Deflate UTSW 8 109851132 critical splice donor site probably null
depress UTSW 8 109838920 missense probably damaging 1.00
R0158:Ap1g1 UTSW 8 109855635 missense probably benign 0.00
R0226:Ap1g1 UTSW 8 109855062 missense probably benign 0.39
R0254:Ap1g1 UTSW 8 109803117 missense probably benign 0.01
R0315:Ap1g1 UTSW 8 109819035 missense probably benign
R0380:Ap1g1 UTSW 8 109803164 splice site probably benign
R0471:Ap1g1 UTSW 8 109853643 missense possibly damaging 0.90
R0508:Ap1g1 UTSW 8 109837732 splice site probably benign
R0837:Ap1g1 UTSW 8 109851065 missense probably damaging 1.00
R1025:Ap1g1 UTSW 8 109818939 missense probably benign 0.24
R1700:Ap1g1 UTSW 8 109853612 missense probably damaging 1.00
R1759:Ap1g1 UTSW 8 109833221 missense probably damaging 1.00
R1809:Ap1g1 UTSW 8 109833182 splice site probably benign
R2161:Ap1g1 UTSW 8 109844354 missense probably damaging 1.00
R3428:Ap1g1 UTSW 8 109843448 missense probably damaging 1.00
R3772:Ap1g1 UTSW 8 109837786 missense probably damaging 1.00
R4244:Ap1g1 UTSW 8 109833490 missense probably benign 0.04
R4714:Ap1g1 UTSW 8 109829620 missense probably damaging 0.98
R4736:Ap1g1 UTSW 8 109855082 missense possibly damaging 0.93
R5173:Ap1g1 UTSW 8 109851132 critical splice donor site probably null
R5185:Ap1g1 UTSW 8 109863326 utr 3 prime probably benign
R5435:Ap1g1 UTSW 8 109838920 missense probably damaging 1.00
R5685:Ap1g1 UTSW 8 109837783 missense probably damaging 0.99
R5824:Ap1g1 UTSW 8 109838912 splice site probably null
R5867:Ap1g1 UTSW 8 109818982 missense probably damaging 1.00
R6339:Ap1g1 UTSW 8 109844368 missense possibly damaging 0.85
R6978:Ap1g1 UTSW 8 109828336 critical splice donor site probably null
R7532:Ap1g1 UTSW 8 109860164 missense not run
Predicted Primers PCR Primer
(F):5'- AAATGGCCCTTCGGAGATCG -3'
(R):5'- TCAGTATCTTTTACCCCAAGATGTC -3'

Sequencing Primer
(F):5'- AAGCCAGGTCCTTGTCTGG -3'
(R):5'- TACCCCAAGATGTCTATCTACCC -3'
Posted On2015-04-17