Incidental Mutation 'R3897:Pabpc6'
ID309027
Institutional Source Beutler Lab
Gene Symbol Pabpc6
Ensembl Gene ENSMUSG00000046173
Gene Namepoly(A) binding protein, cytoplasmic 6
Synonyms4932702K14Rik
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location9666497-9669704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9669127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 165 (D165G)
Ref Sequence ENSEMBL: ENSMUSP00000050792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057190]
Predicted Effect probably benign
Transcript: ENSMUST00000057190
AA Change: D165G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050792
Gene: ENSMUSG00000046173
AA Change: D165G

DomainStartEndE-ValueType
RRM 12 85 1.78e-20 SMART
RRM 100 171 2.54e-25 SMART
RRM 192 264 1.08e-28 SMART
RRM 305 376 7.57e-24 SMART
low complexity region 500 511 N/A INTRINSIC
PolyA 561 624 3.28e-34 SMART
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Pabpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Pabpc6 APN 17 9668498 missense possibly damaging 0.80
IGL00984:Pabpc6 APN 17 9668689 missense probably damaging 1.00
IGL01123:Pabpc6 APN 17 9668147 missense probably benign 0.01
IGL01301:Pabpc6 APN 17 9667970 missense probably benign
IGL02347:Pabpc6 APN 17 9669064 missense probably benign 0.03
ANU18:Pabpc6 UTSW 17 9667970 missense probably benign
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R1593:Pabpc6 UTSW 17 9667813 missense probably damaging 0.98
R1695:Pabpc6 UTSW 17 9668074 missense probably benign 0.01
R3903:Pabpc6 UTSW 17 9669154 missense probably benign 0.16
R4585:Pabpc6 UTSW 17 9669073 missense probably damaging 1.00
R5009:Pabpc6 UTSW 17 9668560 missense probably damaging 1.00
R5112:Pabpc6 UTSW 17 9669611 missense probably damaging 1.00
R5769:Pabpc6 UTSW 17 9667843 nonsense probably null
R6174:Pabpc6 UTSW 17 9668155 missense probably benign
R6488:Pabpc6 UTSW 17 9669599 missense probably damaging 1.00
R7140:Pabpc6 UTSW 17 9668428 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCCTTTCAAAGCTTACGAATCC -3'
(R):5'- GATCCATTGACAGTAAAACGCTG -3'

Sequencing Primer
(F):5'- AGCTTACGAATCCGAATCCTTTGG -3'
(R):5'- AAACGCTGTATGATACGTTTTCTGCC -3'
Posted On2015-04-17