Mutagenetix > Incidental Mutation

Incidental Mutation 'R3898:Cad'

309046

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

2410008J01Rik

MMRRC Submission

040906-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R3898 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31212124-31235823 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 31231366 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1633 (C1633F)

Ref Sequence

ENSEMBL: ENSMUSP00000144307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]

AlphaFold

B2RQC6

Predicted Effect

probably benign
Transcript: ENSMUST00000013773
AA Change: C1696F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: C1696F

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200917

Predicted Effect

probably benign
Transcript: ENSMUST00000200953
AA Change: C1633F

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: C1633F

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201182
AA Change: C1696F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: C1696F

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202391

Predicted Effect

probably benign
Transcript: ENSMUST00000202795
AA Change: C1696F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: C1696F

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202827

Predicted Effect

probably benign
Transcript: ENSMUST00000202973

SMART Domains

Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
SCOP:d1gkra1	1	84	4e-28	SMART
PDB:4C6N\|A	1	119	4e-58	PDB
low complexity region	156	170	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg1	A	C	16: 5,054,253 (GRCm39)	I154L	possibly damaging	Het
Ankra2	C	T	13: 98,410,317 (GRCm39)	L136F	probably benign	Het
Anpep	A	G	7: 79,488,973 (GRCm39)	S372P	probably benign	Het
Cabyr	T	C	18: 12,884,580 (GRCm39)	S356P	probably benign	Het
Cadps2	G	A	6: 23,528,125 (GRCm39)	R425W	probably damaging	Het
Ccdc180	A	G	4: 45,912,799 (GRCm39)	K593E	possibly damaging	Het
Cdh8	T	A	8: 99,898,005 (GRCm39)	E436V	probably damaging	Het
Cfap95	A	G	19: 23,570,466 (GRCm39)	V101A	probably benign	Het
Cln6	T	G	9: 62,757,934 (GRCm39)	F231C	probably damaging	Het
Cul2	A	G	18: 3,434,033 (GRCm39)	K677E	probably benign	Het
Cyp2c69	T	C	19: 39,864,834 (GRCm39)	I215V	probably benign	Het
Dhx36	T	C	3: 62,399,790 (GRCm39)	D393G	probably damaging	Het
Dnah7b	T	C	1: 46,282,417 (GRCm39)	V2850A	probably damaging	Het
Dnah8	G	A	17: 31,073,872 (GRCm39)	R4514H	probably damaging	Het
Drg2	T	A	11: 60,347,460 (GRCm39)	S50T	probably benign	Het
Ecscr	A	G	18: 35,846,705 (GRCm39)	S230P	possibly damaging	Het
Eif2ak4	T	C	2: 118,261,404 (GRCm39)	V527A	probably damaging	Het
Elfn1	G	A	5: 139,957,719 (GRCm39)	R241H	probably damaging	Het
Fchsd2	A	G	7: 100,841,006 (GRCm39)	K172E	possibly damaging	Het
Fli1	C	T	9: 32,388,018 (GRCm39)	G24R	possibly damaging	Het
Frmd3	A	G	4: 73,992,346 (GRCm39)	D71G	probably damaging	Het
Ggnbp1	A	G	17: 27,244,312 (GRCm39)		probably benign	Het
Gpat2	T	C	2: 127,277,018 (GRCm39)	F713S	probably damaging	Het
H2-Q2	C	T	17: 35,561,743 (GRCm39)	P78S	probably damaging	Het
Kcnq2	C	T	2: 180,751,479 (GRCm39)	A306T	probably damaging	Het
Lmntd1	G	A	6: 145,359,152 (GRCm39)	P333S	probably benign	Het
Lrp1	G	A	10: 127,427,969 (GRCm39)	R535*	probably null	Het
Mmrn2	G	T	14: 34,121,517 (GRCm39)		probably null	Het
Nlrp1a	G	A	11: 71,013,700 (GRCm39)	P517S	probably benign	Het
Or2y13	A	T	11: 49,415,386 (GRCm39)	I279F	probably damaging	Het
Pou4f1	T	C	14: 104,703,165 (GRCm39)	*422W	probably null	Het
Ptpn14	C	T	1: 189,582,728 (GRCm39)	P525L	probably benign	Het
Pyroxd2	C	A	19: 42,728,831 (GRCm39)	G190C	probably damaging	Het
Rd3	T	C	1: 191,717,217 (GRCm39)	V114A	probably damaging	Het
Sptbn5	T	C	2: 119,887,691 (GRCm39)		noncoding transcript	Het
Tbc1d5	A	T	17: 51,270,772 (GRCm39)	F153Y	probably damaging	Het
Thop1	G	A	10: 80,916,278 (GRCm39)	G429S	probably damaging	Het
Trim30d	T	A	7: 104,132,736 (GRCm39)	I184L	probably benign	Het
Ubr5	T	C	15: 37,997,983 (GRCm39)	S1727G	probably benign	Het
Vezf1	T	C	11: 87,966,999 (GRCm39)	F77L	probably benign	Het
Vmn2r12	C	T	5: 109,238,370 (GRCm39)	A457T	probably benign	Het
Xirp1	A	T	9: 119,848,406 (GRCm39)	M159K	probably benign	Het
Zkscan17	C	T	11: 59,394,263 (GRCm39)	A113T	probably damaging	Het
Zyg11a	T	A	4: 108,067,391 (GRCm39)	N40Y	probably damaging	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31,218,828 (GRCm39)	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31,216,398 (GRCm39)	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31,219,114 (GRCm39)	splice site	probably benign
IGL01638:Cad	APN	5	31,224,958 (GRCm39)	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31,218,170 (GRCm39)	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31,226,948 (GRCm39)	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31,212,638 (GRCm39)	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31,212,330 (GRCm39)	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31,229,438 (GRCm39)	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31,235,454 (GRCm39)	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31,229,665 (GRCm39)	missense	probably benign	0.01
R0335:Cad	UTSW	5	31,231,329 (GRCm39)	unclassified	probably benign
R0401:Cad	UTSW	5	31,231,330 (GRCm39)	unclassified	probably benign
R0445:Cad	UTSW	5	31,230,053 (GRCm39)	missense	probably benign	0.08
R0494:Cad	UTSW	5	31,234,856 (GRCm39)	unclassified	probably benign
R0532:Cad	UTSW	5	31,219,531 (GRCm39)	splice site	probably benign
R0539:Cad	UTSW	5	31,232,801 (GRCm39)	splice site	probably benign
R0578:Cad	UTSW	5	31,216,120 (GRCm39)	missense	probably benign	0.01
R0590:Cad	UTSW	5	31,219,575 (GRCm39)	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31,235,032 (GRCm39)	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31,224,944 (GRCm39)	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31,216,926 (GRCm39)	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31,226,106 (GRCm39)	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31,233,563 (GRCm39)	missense	probably benign	0.14
R1763:Cad	UTSW	5	31,218,295 (GRCm39)	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31,219,564 (GRCm39)	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31,219,018 (GRCm39)	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31,231,481 (GRCm39)	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31,232,890 (GRCm39)	splice site	probably null
R3847:Cad	UTSW	5	31,218,994 (GRCm39)	missense	probably damaging	1.00
R3943:Cad	UTSW	5	31,229,729 (GRCm39)	critical splice donor site	probably null
R4213:Cad	UTSW	5	31,229,688 (GRCm39)	missense	probably benign	0.01
R4458:Cad	UTSW	5	31,218,570 (GRCm39)	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31,215,477 (GRCm39)	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31,227,639 (GRCm39)	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31,224,030 (GRCm39)	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31,232,034 (GRCm39)	missense	probably benign	0.02
R5044:Cad	UTSW	5	31,212,365 (GRCm39)	missense	probably benign	0.00
R5630:Cad	UTSW	5	31,217,917 (GRCm39)	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31,234,191 (GRCm39)	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31,226,456 (GRCm39)	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31,212,327 (GRCm39)	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31,219,906 (GRCm39)	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31,230,322 (GRCm39)	missense	probably benign	0.00
R6260:Cad	UTSW	5	31,224,144 (GRCm39)	missense	probably null
R7145:Cad	UTSW	5	31,224,956 (GRCm39)	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31,217,557 (GRCm39)	critical splice donor site	probably null
R7352:Cad	UTSW	5	31,215,422 (GRCm39)	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31,233,173 (GRCm39)	missense	probably benign
R7387:Cad	UTSW	5	31,219,284 (GRCm39)	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31,231,506 (GRCm39)	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31,226,392 (GRCm39)	missense	probably benign
R7627:Cad	UTSW	5	31,217,508 (GRCm39)	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31,218,829 (GRCm39)	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31,226,150 (GRCm39)	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31,218,271 (GRCm39)	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31,233,165 (GRCm39)	missense	probably benign	0.00
R8523:Cad	UTSW	5	31,215,450 (GRCm39)	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31,232,500 (GRCm39)	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31,231,945 (GRCm39)	missense	probably benign	0.06
R8698:Cad	UTSW	5	31,234,819 (GRCm39)	missense	probably benign
R8699:Cad	UTSW	5	31,233,605 (GRCm39)	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31,226,908 (GRCm39)	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31,225,009 (GRCm39)	missense	probably null
R9272:Cad	UTSW	5	31,218,576 (GRCm39)	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31,230,000 (GRCm39)	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31,234,988 (GRCm39)	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31,228,018 (GRCm39)	critical splice donor site	probably null
R9665:Cad	UTSW	5	31,229,703 (GRCm39)	missense	probably benign	0.28
RF001:Cad	UTSW	5	31,217,556 (GRCm39)	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31,217,556 (GRCm39)	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31,225,475 (GRCm39)	missense	probably null	1.00
X0022:Cad	UTSW	5	31,229,661 (GRCm39)	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31,232,472 (GRCm39)	missense	probably benign	0.25
Z1177:Cad	UTSW	5	31,225,765 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGTCCTTAAGCACAGGGATTG -3'
(R):5'- ACCGCTCACCTCTACATAGG -3'

Sequencing Primer
(F):5'- TCCTTAAGCACAGGGATTGACAAATG -3'
(R):5'- CTACATAGGTGTCCTCCTGGAGAG -3'

Posted On

2015-04-17