Incidental Mutation 'R3898:Fli1'
ID309057
Institutional Source Beutler Lab
Gene Symbol Fli1
Ensembl Gene ENSMUSG00000016087
Gene NameFriend leukemia integration 1
SynonymsSIC-1, EWSR2, Sic1, Fli-1
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32422204-32542861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32476722 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000016231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016231
AA Change: G24R

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: G24R

DomainStartEndE-ValueType
SAM_PNT 114 198 2.52e-38 SMART
ETS 280 365 1.22e-57 SMART
low complexity region 402 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183767
SMART Domains Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087

DomainStartEndE-ValueType
SAM_PNT 81 165 2.52e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192646
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Fli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Fli1 APN 9 32423940 missense probably benign 0.31
IGL01329:Fli1 APN 9 32424101 missense probably damaging 1.00
IGL01925:Fli1 APN 9 32465831 missense probably damaging 1.00
IGL01951:Fli1 APN 9 32461364 missense probably damaging 0.99
IGL01963:Fli1 APN 9 32424207 nonsense probably null
IGL02889:Fli1 APN 9 32465696 missense probably damaging 1.00
R0026:Fli1 UTSW 9 32476584 missense probably damaging 1.00
R0243:Fli1 UTSW 9 32423981 missense probably benign 0.00
R0279:Fli1 UTSW 9 32461427 missense probably damaging 1.00
R0418:Fli1 UTSW 9 32452129 splice site probably benign
R0967:Fli1 UTSW 9 32461449 missense probably benign
R1228:Fli1 UTSW 9 32423843 missense probably damaging 1.00
R1557:Fli1 UTSW 9 32461244 splice site probably benign
R1875:Fli1 UTSW 9 32423913 missense probably benign 0.03
R3401:Fli1 UTSW 9 32461274 missense probably damaging 1.00
R4051:Fli1 UTSW 9 32452162 missense probably benign 0.03
R6440:Fli1 UTSW 9 32423901 missense probably benign 0.07
R6901:Fli1 UTSW 9 32429925 missense probably benign 0.14
R7061:Fli1 UTSW 9 32424222 missense probably damaging 0.98
R7231:Fli1 UTSW 9 32424188 missense not run
Predicted Primers PCR Primer
(F):5'- CTTCCCTGCTTCATGAGGAC -3'
(R):5'- GTGCTGACACTGTGAATCTATTAC -3'

Sequencing Primer
(F):5'- TTCATGAGGACTGGCCAACTCTG -3'
(R):5'- CCTTGAACAGTTACAGCTTCATGAG -3'
Posted On2015-04-17