Incidental Mutation 'R3898:Olfr1383'
ID309064
Institutional Source Beutler Lab
Gene Symbol Olfr1383
Ensembl Gene ENSMUSG00000107417
Gene Nameolfactory receptor 1383
SynonymsMOR256-56, GA_x6K02T2QP88-5912627-5911692
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49519648-49527199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49524559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 279 (I279F)
Ref Sequence ENSEMBL: ENSMUSP00000145258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077143] [ENSMUST00000204706] [ENSMUST00000213152] [ENSMUST00000213707] [ENSMUST00000213899] [ENSMUST00000217564]
Predicted Effect probably damaging
Transcript: ENSMUST00000077143
AA Change: I279F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076390
Gene: ENSMUSG00000107417
AA Change: I279F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204706
AA Change: I279F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145258
Gene: ENSMUSG00000107417
AA Change: I279F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213152
Predicted Effect probably benign
Transcript: ENSMUST00000213707
Predicted Effect probably benign
Transcript: ENSMUST00000213899
Predicted Effect probably benign
Transcript: ENSMUST00000217564
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Olfr1383
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:Olfr1383 APN 11 49523744 missense possibly damaging 0.56
IGL03178:Olfr1383 APN 11 49523990 missense possibly damaging 0.90
R0089:Olfr1383 UTSW 11 49524206 missense possibly damaging 0.67
R0112:Olfr1383 UTSW 11 49524134 missense possibly damaging 0.70
R0243:Olfr1383 UTSW 11 49523912 missense probably damaging 1.00
R0445:Olfr1383 UTSW 11 49523957 missense probably damaging 1.00
R0646:Olfr1383 UTSW 11 49524578 missense probably damaging 1.00
R1695:Olfr1383 UTSW 11 49524335 missense probably benign 0.32
R2142:Olfr1383 UTSW 11 49523839 missense probably benign 0.00
R4085:Olfr1383 UTSW 11 49524128 missense probably benign 0.23
R5677:Olfr1383 UTSW 11 49523944 missense probably damaging 0.98
R6187:Olfr1383 UTSW 11 49523511 unclassified probably benign
R6272:Olfr1383 UTSW 11 49524126 missense possibly damaging 0.67
R6287:Olfr1383 UTSW 11 49524245 missense probably damaging 0.99
R6898:Olfr1383 UTSW 11 49523709 unclassified probably benign
X0017:Olfr1383 UTSW 11 49524002 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTCATGCAGTGTTGAAGATC -3'
(R):5'- AGAAGTACAATCATGATGCCTACTGAG -3'

Sequencing Primer
(F):5'- GCTCATGCAGTGTTGAAGATCAAGTC -3'
(R):5'- CTGGAGAATAATAGGTCTCTATAGGC -3'
Posted On2015-04-17