Incidental Mutation 'R3898:Tbc1d5'
ID309076
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50963744 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 153 (F153Y)
Ref Sequence ENSEMBL: ENSMUSP00000024717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably damaging
Transcript: ENSMUST00000024717
AA Change: F153Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: F153Y

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224123
Predicted Effect possibly damaging
Transcript: ENSMUST00000224528
AA Change: F153Y

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTAAAGCATGTGGAATCCTG -3'
(R):5'- GCGAGAGAAACTTCACAAGTGC -3'

Sequencing Primer
(F):5'- AGCATGTGGAATCCTGCAGTC -3'
(R):5'- CTTCACAAGTGCACTCAGTAAGGG -3'
Posted On2015-04-17