Incidental Mutation 'R3905:Rxfp2'
ID 309140
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Name relaxin/insulin-like family peptide receptor 2
Synonyms LGR8, Gpr106, Great
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3905 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 149942140-150005649 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 149979450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
AlphaFold Q91ZZ5
Predicted Effect probably null
Transcript: ENSMUST00000065745
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110496
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably null
Transcript: ENSMUST00000201612
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,307,389 (GRCm39) I1964N possibly damaging Het
Abca12 A G 1: 71,318,616 (GRCm39) F1796L probably benign Het
Abca17 T A 17: 24,515,257 (GRCm39) M821L probably benign Het
Adamts3 C A 5: 90,009,214 (GRCm39) G150C probably damaging Het
Ap4b1 A T 3: 103,726,209 (GRCm39) I262F possibly damaging Het
Atp1a1 T A 3: 101,497,928 (GRCm39) E286D probably benign Het
Bard1 T C 1: 71,106,339 (GRCm39) I429M possibly damaging Het
Bcl7c T C 7: 127,266,155 (GRCm39) R198G possibly damaging Het
Cacna1s T A 1: 136,012,007 (GRCm39) M483K probably damaging Het
Ccdc159 T A 9: 21,845,815 (GRCm39) probably null Het
Cct7 A T 6: 85,443,690 (GRCm39) I353F possibly damaging Het
Cfap57 A G 4: 118,453,036 (GRCm39) Y556H probably damaging Het
Fat1 G C 8: 45,476,072 (GRCm39) R1706T probably benign Het
Fn1 C T 1: 71,647,072 (GRCm39) G1482R probably damaging Het
Gcat T C 15: 78,927,531 (GRCm39) L324P possibly damaging Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Il22 C T 10: 118,041,529 (GRCm39) R81* probably null Het
Impa1 T C 3: 10,381,094 (GRCm39) T263A probably benign Het
Kif13a T C 13: 46,956,166 (GRCm39) Y609C probably damaging Het
Kmt2e A G 5: 23,706,624 (GRCm39) N1396D probably benign Het
Lrfn1 G A 7: 28,166,294 (GRCm39) G563R possibly damaging Het
Mark1 A C 1: 184,640,632 (GRCm39) probably null Het
Mxd1 G T 6: 86,627,942 (GRCm39) Q199K probably benign Het
Myo3a T A 2: 22,448,227 (GRCm39) Y1N probably damaging Het
Nek3 T C 8: 22,623,107 (GRCm39) E309G probably benign Het
Or10h28 T C 17: 33,487,749 (GRCm39) F17S probably damaging Het
Otoa A T 7: 120,724,788 (GRCm39) Q489L probably damaging Het
Oxsr1 T C 9: 119,076,178 (GRCm39) E376G probably benign Het
Piezo1 C T 8: 123,208,882 (GRCm39) E2494K probably damaging Het
Pkd1l3 A G 8: 110,373,511 (GRCm39) H1349R probably benign Het
Psmd2 A G 16: 20,474,392 (GRCm39) D316G probably benign Het
Pwwp3a T C 10: 80,074,150 (GRCm39) V401A probably damaging Het
Robo4 T A 9: 37,314,801 (GRCm39) C218* probably null Het
Slc10a1 A G 12: 81,014,441 (GRCm39) I93T probably damaging Het
Tarbp1 C T 8: 127,154,891 (GRCm39) R1411Q probably damaging Het
Tbl3 C T 17: 24,921,006 (GRCm39) D563N probably damaging Het
Tec A G 5: 72,917,705 (GRCm39) S505P probably damaging Het
Toporsl A T 4: 52,611,750 (GRCm39) R548* probably null Het
Vmn1r39 G A 6: 66,781,479 (GRCm39) Q243* probably null Het
Vmn2r9 C A 5: 108,995,785 (GRCm39) A288S probably benign Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 149,989,893 (GRCm39) missense probably benign
IGL00984:Rxfp2 APN 5 149,990,597 (GRCm39) missense probably benign 0.24
IGL02475:Rxfp2 APN 5 149,987,151 (GRCm39) missense probably benign 0.07
IGL02637:Rxfp2 APN 5 149,979,378 (GRCm39) missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 149,975,021 (GRCm39) missense probably benign 0.01
IGL03052:Rxfp2 APN 5 149,966,645 (GRCm39) splice site probably benign
IGL03203:Rxfp2 APN 5 149,987,145 (GRCm39) missense probably benign 0.08
R0158:Rxfp2 UTSW 5 149,975,093 (GRCm39) missense probably benign 0.14
R0394:Rxfp2 UTSW 5 149,990,853 (GRCm39) missense probably benign 0.03
R0499:Rxfp2 UTSW 5 149,989,880 (GRCm39) missense probably damaging 1.00
R0576:Rxfp2 UTSW 5 149,961,712 (GRCm39) missense probably benign 0.01
R0720:Rxfp2 UTSW 5 149,967,584 (GRCm39) missense probably benign 0.04
R1172:Rxfp2 UTSW 5 149,975,021 (GRCm39) missense probably benign 0.01
R1173:Rxfp2 UTSW 5 149,975,021 (GRCm39) missense probably benign 0.01
R1174:Rxfp2 UTSW 5 149,975,021 (GRCm39) missense probably benign 0.01
R1175:Rxfp2 UTSW 5 149,975,021 (GRCm39) missense probably benign 0.01
R1606:Rxfp2 UTSW 5 149,983,362 (GRCm39) missense probably benign
R1720:Rxfp2 UTSW 5 149,966,564 (GRCm39) nonsense probably null
R2040:Rxfp2 UTSW 5 149,993,677 (GRCm39) missense probably benign
R3029:Rxfp2 UTSW 5 149,966,595 (GRCm39) missense probably benign 0.05
R4056:Rxfp2 UTSW 5 149,975,098 (GRCm39) critical splice donor site probably null
R4156:Rxfp2 UTSW 5 149,975,020 (GRCm39) missense probably benign 0.01
R4282:Rxfp2 UTSW 5 149,993,735 (GRCm39) missense possibly damaging 0.94
R4418:Rxfp2 UTSW 5 149,972,265 (GRCm39) missense probably benign
R4935:Rxfp2 UTSW 5 149,975,097 (GRCm39) critical splice donor site probably null
R5010:Rxfp2 UTSW 5 149,990,825 (GRCm39) missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 149,958,909 (GRCm39) missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 149,993,725 (GRCm39) missense probably benign 0.21
R5374:Rxfp2 UTSW 5 149,993,725 (GRCm39) missense probably benign 0.21
R5530:Rxfp2 UTSW 5 149,980,275 (GRCm39) missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 149,966,589 (GRCm39) missense probably benign 0.00
R6021:Rxfp2 UTSW 5 149,987,202 (GRCm39) missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 149,967,591 (GRCm39) splice site probably null
R6401:Rxfp2 UTSW 5 149,966,595 (GRCm39) missense probably benign
R6841:Rxfp2 UTSW 5 149,942,210 (GRCm39) start gained probably benign
R6981:Rxfp2 UTSW 5 149,972,313 (GRCm39) splice site probably null
R7012:Rxfp2 UTSW 5 150,004,659 (GRCm39) missense probably benign 0.00
R7032:Rxfp2 UTSW 5 149,993,813 (GRCm39) missense probably damaging 1.00
R7151:Rxfp2 UTSW 5 149,966,572 (GRCm39) missense probably benign 0.01
R7205:Rxfp2 UTSW 5 149,983,368 (GRCm39) missense probably benign 0.00
R7205:Rxfp2 UTSW 5 149,983,364 (GRCm39) missense probably benign 0.05
R7209:Rxfp2 UTSW 5 149,976,563 (GRCm39) splice site probably null
R7468:Rxfp2 UTSW 5 149,990,801 (GRCm39) missense possibly damaging 0.70
R7475:Rxfp2 UTSW 5 149,973,046 (GRCm39) missense possibly damaging 0.94
R8181:Rxfp2 UTSW 5 149,987,201 (GRCm39) missense probably benign 0.22
R8258:Rxfp2 UTSW 5 149,983,365 (GRCm39) missense probably damaging 0.97
R8259:Rxfp2 UTSW 5 149,983,365 (GRCm39) missense probably damaging 0.97
R8443:Rxfp2 UTSW 5 149,973,068 (GRCm39) missense possibly damaging 0.45
R8470:Rxfp2 UTSW 5 149,993,834 (GRCm39) missense possibly damaging 0.94
R8796:Rxfp2 UTSW 5 149,942,262 (GRCm39) start gained probably benign
R8906:Rxfp2 UTSW 5 149,989,888 (GRCm39) missense possibly damaging 0.90
R9515:Rxfp2 UTSW 5 149,979,444 (GRCm39) missense possibly damaging 0.61
R9682:Rxfp2 UTSW 5 149,966,564 (GRCm39) nonsense probably null
R9732:Rxfp2 UTSW 5 149,993,767 (GRCm39) missense probably damaging 1.00
X0067:Rxfp2 UTSW 5 149,975,083 (GRCm39) missense probably damaging 1.00
Z1177:Rxfp2 UTSW 5 149,972,275 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGCCAAGAGAGATAC -3'
(R):5'- CACTGTGCAGTAAAGCGATTTC -3'

Sequencing Primer
(F):5'- TCCCACCCCAAATATCTAATGGTTC -3'
(R):5'- GCAGTAAAGCGATTTCATTTCACGG -3'
Posted On 2015-04-17