Incidental Mutation 'R3905:Vmn1r39'
ID309141
Institutional Source Beutler Lab
Gene Symbol Vmn1r39
Ensembl Gene ENSMUSG00000093755
Gene Namevomeronasal 1 receptor 39
SynonymsGm5993
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66803297-66810609 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 66804495 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 243 (Q243*)
Ref Sequence ENSEMBL: ENSMUSP00000154432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089918] [ENSMUST00000226217] [ENSMUST00000226783] [ENSMUST00000227285] [ENSMUST00000227555] [ENSMUST00000228008] [ENSMUST00000228651] [ENSMUST00000228862] [ENSMUST00000228919]
Predicted Effect probably null
Transcript: ENSMUST00000089918
AA Change: Q280*
SMART Domains Protein: ENSMUSP00000087364
Gene: ENSMUSG00000093755
AA Change: Q280*

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.5e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226217
AA Change: Q280*
Predicted Effect probably null
Transcript: ENSMUST00000226783
AA Change: Q280*
Predicted Effect probably null
Transcript: ENSMUST00000227285
AA Change: Q243*
Predicted Effect probably null
Transcript: ENSMUST00000227555
AA Change: Q280*
Predicted Effect probably null
Transcript: ENSMUST00000228008
AA Change: Q243*
Predicted Effect probably null
Transcript: ENSMUST00000228651
AA Change: Q243*
Predicted Effect probably null
Transcript: ENSMUST00000228862
AA Change: Q280*
Predicted Effect probably null
Transcript: ENSMUST00000228919
AA Change: Q243*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Vmn1r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Vmn1r39 APN 6 66804962 missense probably benign 0.05
R0189:Vmn1r39 UTSW 6 66805197 missense probably benign 0.10
R1132:Vmn1r39 UTSW 6 66804444 missense probably benign
R1803:Vmn1r39 UTSW 6 66804911 missense probably benign 0.00
R1839:Vmn1r39 UTSW 6 66805233 critical splice acceptor site probably null
R2966:Vmn1r39 UTSW 6 66804731 missense possibly damaging 0.94
R3747:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3748:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3756:Vmn1r39 UTSW 6 66804879 missense probably damaging 0.97
R3912:Vmn1r39 UTSW 6 66805141 missense probably benign
R4226:Vmn1r39 UTSW 6 66804719 missense possibly damaging 0.78
R4426:Vmn1r39 UTSW 6 66805361 unclassified probably null
R5493:Vmn1r39 UTSW 6 66804770 missense probably damaging 0.97
R6498:Vmn1r39 UTSW 6 66804857 missense probably damaging 1.00
R6944:Vmn1r39 UTSW 6 66805221 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGGCCAGAGCAATCG -3'
(R):5'- GAGCATCCCCTGAGAAAAGG -3'

Sequencing Primer
(F):5'- TGTACTACCAGATCCAGGGGATTC -3'
(R):5'- GGCCACCCAGACCATCTTG -3'
Posted On2015-04-17