Incidental Mutation 'R3902:Pdgfra'
ID309228
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75192508 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 986 (N986K)
Ref Sequence ENSEMBL: ENSMUSP00000127173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: N986K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: N986K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: N986K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: N986K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6297:Pdgfra UTSW 5 75173474 missense possibly damaging 0.88
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTATGCGTAGGTCAGGAAGC -3'
(R):5'- GGAAGGTGGCTGTAGTTACC -3'

Sequencing Primer
(F):5'- CTTAAAGGTTGGGGTGGAGAGAGTC -3'
(R):5'- AAGGTGGCTGTAGTTACCTGTGTC -3'
Posted On2015-04-17