Incidental Mutation 'R3910:4931409K22Rik'
ID309333
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 24545442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048302] [ENSMUST00000088302] [ENSMUST00000117900] [ENSMUST00000119657] [ENSMUST00000200634]
Predicted Effect probably benign
Transcript: ENSMUST00000048302
SMART Domains Protein: ENSMUSP00000041539
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 422 461 6.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088302
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117900
SMART Domains Protein: ENSMUSP00000112743
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 100 129 2.62e-4 SMART
ANK 132 161 3.51e-5 SMART
ANK 165 194 7.99e2 SMART
ANK 199 228 1.44e-1 SMART
ANK 232 274 2.39e2 SMART
ANK 278 307 3.01e-4 SMART
ANK 311 347 1.46e2 SMART
SOCS_box 407 446 6.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119657
SMART Domains Protein: ENSMUSP00000113328
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 384 423 6.77e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTGAATGACTTGAGCAAGACTTCC -3'
(R):5'- ACAGCAGGGTGGGATTTCTG -3'

Sequencing Primer
(F):5'- TTGAGCAAGACTTCCAGCCTG -3'
(R):5'- GAATCTTTCCAGTAACTCCTGTGGG -3'
Posted On2015-04-17