Incidental Mutation 'R3910:Krt90'
ID309352
Institutional Source Beutler Lab
Gene Symbol Krt90
Ensembl Gene ENSMUSG00000048699
Gene Namekeratin 90
Synonyms4732456N10Rik
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101552356-101562950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101562783 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 15 (R15W)
Ref Sequence ENSEMBL: ENSMUSP00000023714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]
Predicted Effect probably damaging
Transcript: ENSMUST00000023714
AA Change: R15W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699
AA Change: R15W

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit partial prenatal lethality and thickened long toenails. An increased caudal vertebrae number is observed in some mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Krt90
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Krt90 UTSW 15 101562675 missense possibly damaging 0.78
R0732:Krt90 UTSW 15 101560425 missense possibly damaging 0.60
R1036:Krt90 UTSW 15 101562716 missense probably benign 0.05
R1616:Krt90 UTSW 15 101560591 missense possibly damaging 0.46
R1750:Krt90 UTSW 15 101553365 unclassified probably benign
R1919:Krt90 UTSW 15 101557230 missense probably damaging 1.00
R2063:Krt90 UTSW 15 101558359 missense probably benign 0.07
R2107:Krt90 UTSW 15 101562629 missense probably benign 0.06
R2155:Krt90 UTSW 15 101562611 missense probably benign 0.00
R2404:Krt90 UTSW 15 101554670 critical splice donor site probably null
R3412:Krt90 UTSW 15 101560593 missense probably damaging 1.00
R3911:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3913:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R4476:Krt90 UTSW 15 101557283 missense probably damaging 1.00
R4748:Krt90 UTSW 15 101555333 missense probably damaging 1.00
R4918:Krt90 UTSW 15 101562479 missense possibly damaging 0.47
R5883:Krt90 UTSW 15 101553219 unclassified probably benign
R6416:Krt90 UTSW 15 101559244 missense probably benign 0.12
R6674:Krt90 UTSW 15 101557326 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCCTATGCCGCTGACACC -3'
(R):5'- TCTTTGATCTACTCTGGCCAAG -3'

Sequencing Primer
(F):5'- CAAAGCTGGCTCGGGTG -3'
(R):5'- CCAAGCCCAGTTCTTGAAAGGG -3'
Posted On2015-04-17