Incidental Mutation 'R3911:Kirrel'
ID309367
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Namekirre like nephrin family adhesion molecule 1
SynonymsKirrel1, 6720469N11Rik, Neph1
MMRRC Submission 040909-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3911 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87078593-87174747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87089151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Abcb9 T A 5: 124,089,846 I111F probably benign Het
Abcc12 A C 8: 86,528,419 probably benign Het
Adgre1 G T 17: 57,447,860 V653L probably damaging Het
Aebp2 T A 6: 140,647,981 D230E probably damaging Het
Asap3 A G 4: 136,229,457 probably benign Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Casp8 A T 1: 58,833,705 S267C probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Cd2ap T A 17: 42,816,089 probably null Het
Clip1 T A 5: 123,590,834 E1155D probably damaging Het
Cnnm2 A G 19: 46,877,936 E841G probably damaging Het
Cntrl G A 2: 35,120,049 R245H probably damaging Het
Cyp2b23 A T 7: 26,681,417 S128T probably benign Het
Dhrs11 A T 11: 84,821,753 I196N probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Edc3 A T 9: 57,748,403 I479F possibly damaging Het
Emg1 T A 6: 124,705,046 M172L probably benign Het
Epha7 G A 4: 28,938,680 V512I probably benign Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Fasl C A 1: 161,788,191 C32F probably benign Het
Flg A T 3: 93,280,000 H253L probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm17067 T A 7: 42,710,680 I43L possibly damaging Het
Gpld1 A G 13: 24,962,322 Y183C probably damaging Het
Gpr137c C A 14: 45,278,935 P327T probably benign Het
Hepacam2 A G 6: 3,494,477 M1T probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Itgb8 T A 12: 119,168,005 E635V possibly damaging Het
Kat14 T C 2: 144,404,062 V469A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Klhl18 A T 9: 110,436,083 L285Q probably damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Krtap4-8 A T 11: 99,780,037 C203S unknown Het
Lsp1 C T 7: 142,486,361 S75F probably damaging Het
Map1b A G 13: 99,431,072 S1714P unknown Het
Mcm2 A G 6: 88,888,252 I481T probably damaging Het
Mcpt9 T C 14: 56,027,679 T122A probably benign Het
Megf10 A T 18: 57,289,393 R947W probably damaging Het
Olfr632 A T 7: 103,937,409 N10Y possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pank4 A G 4: 154,969,601 Y79C probably damaging Het
Pds5b T A 5: 150,746,706 N386K probably benign Het
Pfkm A G 15: 98,125,047 M362V probably benign Het
Phc2 T C 4: 128,743,558 probably null Het
Pou4f1 C T 14: 104,466,175 A274T unknown Het
Proc A G 18: 32,123,705 L303P probably damaging Het
Ptk2b C T 14: 66,157,068 G821D possibly damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Serpinb6c T C 13: 33,893,905 N161D probably benign Het
Sf3b1 G A 1: 55,019,389 Q14* probably null Het
Sh3d19 G A 3: 86,107,227 V442M possibly damaging Het
Slc30a8 A G 15: 52,321,701 I140V probably benign Het
Spata1 T A 3: 146,475,324 N293I probably damaging Het
Strap T G 6: 137,735,382 C10G probably damaging Het
Tcf7 C A 11: 52,282,966 probably benign Het
Tmem114 A T 16: 8,412,190 M116K probably damaging Het
Tmem63b A G 17: 45,677,958 S113P probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Tns2 T C 15: 102,113,837 probably null Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ush2a T A 1: 188,399,954 V791D probably benign Het
Vmn2r99 T C 17: 19,394,373 F785S possibly damaging Het
Wdr35 A T 12: 8,986,077 I283F probably benign Het
Wnt10b G T 15: 98,774,338 A166E possibly damaging Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1876:Kirrel UTSW 3 87089151 missense probably null 0.46
R1995:Kirrel UTSW 3 87095786 missense possibly damaging 0.88
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4067:Kirrel UTSW 3 87088467 nonsense probably null
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4198:Kirrel UTSW 3 87089151 missense probably null 0.46
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4460:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- AGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On2015-04-17