Incidental Mutation 'R0380:Arhgap32'
ID30937
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 038586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0380 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32246477 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 129 (R129W)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802] [ENSMUST00000183121]
Predicted Effect probably damaging
Transcript: ENSMUST00000168954
AA Change: R129W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: R129W

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: R478W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: R478W

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174730
Predicted Effect probably damaging
Transcript: ENSMUST00000182802
AA Change: R129W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: R129W

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183121
SMART Domains Protein: ENSMUSP00000138584
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
Pfam:RhoGAP 37 92 5.9e-11 PFAM
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,588,500 probably null Het
Abca14 A T 7: 120,278,480 I1073L probably benign Het
Adamts17 C T 7: 67,150,044 P1116L probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Ano4 A G 10: 88,978,813 I671T possibly damaging Het
Ap1g1 A G 8: 109,803,164 probably benign Het
Arhgap19 A G 19: 41,773,137 probably benign Het
Atp10b G T 11: 43,225,597 A924S probably damaging Het
Ccdc180 T A 4: 45,930,197 probably null Het
Cckbr A G 7: 105,434,991 T311A probably benign Het
Cr2 C T 1: 195,157,407 G947R probably damaging Het
Cyp2g1 T A 7: 26,814,295 probably benign Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
Doxl2 A G 6: 48,975,839 I233V probably benign Het
Dscam A G 16: 97,056,610 Y67H probably damaging Het
Dsg2 T A 18: 20,582,939 Y282* probably null Het
Epg5 T C 18: 77,960,841 L688P probably damaging Het
Esr2 T G 12: 76,123,291 E458A possibly damaging Het
Fat1 T C 8: 45,010,123 S1326P probably damaging Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gpr12 T A 5: 146,583,336 T259S probably damaging Het
Grm5 T A 7: 88,074,376 C625S possibly damaging Het
H2-Q1 C T 17: 35,323,078 H209Y probably damaging Het
Hcfc2 C A 10: 82,728,438 probably benign Het
Itgal C A 7: 127,310,751 Y495* probably null Het
Kbtbd3 T A 9: 4,330,545 Y306* probably null Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Kif1a T A 1: 93,056,031 probably null Het
Maml2 C T 9: 13,621,100 R537* probably null Het
Muc4 G A 16: 32,752,905 A928T probably benign Het
Nav3 A G 10: 109,758,879 probably benign Het
Neb A T 2: 52,232,202 M605K probably damaging Het
Olfr15 A T 16: 3,838,985 D4V probably benign Het
Pcdhb3 T G 18: 37,302,157 I392S possibly damaging Het
Prune2 A G 19: 17,124,007 T2292A probably damaging Het
Rbbp8nl A T 2: 180,281,719 M108K probably damaging Het
Rbm25 A G 12: 83,660,356 T259A probably benign Het
Recql C A 6: 142,369,430 R243L probably damaging Het
Rsf1 TGGCG TGGCGACGGCGGCG 7: 97,579,905 probably benign Het
Serpinb12 T C 1: 106,950,821 probably null Het
Slc16a14 T A 1: 84,929,530 I8F possibly damaging Het
Spef1 G T 2: 131,172,412 probably benign Het
Tas2r103 A G 6: 133,036,203 L300P probably damaging Het
Tas2r117 A T 6: 132,803,588 R230* probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Thnsl2 A T 6: 71,141,330 L38Q probably damaging Het
Tmem171 G T 13: 98,692,027 T205K possibly damaging Het
Tmem232 A T 17: 65,256,448 L650Q probably benign Het
Tpr T A 1: 150,412,947 D518E probably benign Het
Tsen54 T C 11: 115,822,597 V442A probably damaging Het
Tshz3 A T 7: 36,771,300 I905F probably damaging Het
Vmn1r66 C T 7: 10,274,743 C121Y probably benign Het
Wdfy3 T C 5: 101,948,966 Q322R probably damaging Het
Wdr64 T C 1: 175,769,642 probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAACAGTGGCAAGTGAGCACC -3'
(R):5'- GCAGTAGAAACAGTACCTGGCAGC -3'

Sequencing Primer
(F):5'- AGTGAGCACCACAGCGTG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-04-24