Mutagenetix > Incidental Mutation

Incidental Mutation 'R3912:Ilf2'

309442

Institutional Source

Beutler Lab

Gene Symbol

Ilf2

Ensembl Gene

ENSMUSG00000001016

Gene Name

interleukin enhancer binding factor 2

Synonyms

Tex261, 6230405A16Rik, TEG-267, Tex267

MMRRC Submission

040910-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3912 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90383433-90395686 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90394367 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 295 (N295S)

Ref Sequence

ENSEMBL: ENSMUSP00000001042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001042] [ENSMUST00000149884] [ENSMUST00000184877] [ENSMUST00000185005]

AlphaFold

Q9CXY6

PDB Structure

Crystal structure of the NF90-NF45 dimerisation domain complex [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with ATP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with UTP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with CTP [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000001042
AA Change: N295S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000001042
Gene: ENSMUSG00000001016
AA Change: N295S

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
DZF	98	338	5.01e-142	SMART
low complexity region	353	390	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107352

Predicted Effect

probably benign
Transcript: ENSMUST00000149884

SMART Domains

Protein: ENSMUSP00000122090
Gene: ENSMUSG00000001018

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
Pfam:Snapin_Pallidin	23	110	5.8e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000184877

SMART Domains

Protein: ENSMUSP00000139315
Gene: ENSMUSG00000001018

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185005

SMART Domains

Protein: ENSMUSP00000139160
Gene: ENSMUSG00000001018

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198641

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198738

Meta Mutation Damage Score

0.0638

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot1	A	G	12: 84,063,806 (GRCm39)	S305G	probably damaging	Het
Acot12	A	G	13: 91,918,208 (GRCm39)	D167G	probably benign	Het
Adgra1	T	C	7: 139,425,630 (GRCm39)		probably null	Het
Adh7	T	A	3: 137,927,541 (GRCm39)	V29E	probably damaging	Het
Aopep	G	T	13: 63,304,520 (GRCm39)	E402*	probably null	Het
Atp2c2	A	G	8: 120,448,015 (GRCm39)	K103E	probably damaging	Het
Camkk1	A	G	11: 72,924,642 (GRCm39)	D285G	probably benign	Het
Ccdc158	G	C	5: 92,796,794 (GRCm39)	T514S	possibly damaging	Het
Cdhr5	T	A	7: 140,853,770 (GRCm39)	D210V	probably damaging	Het
Cndp1	C	T	18: 84,650,124 (GRCm39)	D190N	probably benign	Het
Eepd1	C	T	9: 25,394,600 (GRCm39)	T288M	probably damaging	Het
Erbin	G	T	13: 103,998,795 (GRCm39)	T197K	probably benign	Het
Erbin	G	A	13: 104,022,846 (GRCm39)		probably benign	Het
Fnip2	A	T	3: 79,386,812 (GRCm39)	D971E	possibly damaging	Het
Gab2	A	G	7: 96,948,280 (GRCm39)	Y290C	probably damaging	Het
Gbp3	C	T	3: 142,272,099 (GRCm39)		probably benign	Het
Gm14326	T	C	2: 177,587,658 (GRCm39)	K446R	probably damaging	Het
Herc2	T	C	7: 55,748,185 (GRCm39)	Y518H	probably damaging	Het
Id2	T	A	12: 25,145,871 (GRCm39)	K47*	probably null	Het
Ilf3	C	T	9: 21,309,422 (GRCm39)	A526V	possibly damaging	Het
Ints10	T	A	8: 69,266,272 (GRCm39)	S478T	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lrrc7	G	A	3: 157,997,589 (GRCm39)	L158F	probably damaging	Het
Mroh9	C	T	1: 162,893,638 (GRCm39)	C179Y	probably damaging	Het
Mrps18b	C	T	17: 36,221,831 (GRCm39)	V165I	probably benign	Het
Myrip	A	G	9: 120,261,682 (GRCm39)	S432G	probably benign	Het
Nutm2	C	T	13: 50,626,976 (GRCm39)	A377V	possibly damaging	Het
Or2ag18	A	T	7: 106,405,072 (GRCm39)	V199D	probably damaging	Het
Pate4	C	A	9: 35,523,140 (GRCm39)	M1I	probably null	Het
Pax7	C	A	4: 139,508,209 (GRCm39)	W272L	probably benign	Het
Ppp1r12b	C	T	1: 134,815,056 (GRCm39)	E320K	probably damaging	Het
Prg4	T	C	1: 150,327,619 (GRCm39)	Y278C	probably damaging	Het
Pvr	T	C	7: 19,643,217 (GRCm39)	N339D	probably benign	Het
Rev3l	A	G	10: 39,696,552 (GRCm39)	I521M	probably damaging	Het
Ryr2	A	G	13: 11,787,313 (GRCm39)	I1020T	probably damaging	Het
Scn4a	T	A	11: 106,211,542 (GRCm39)	I1492F	probably damaging	Het
Sec16a	C	T	2: 26,304,399 (GRCm39)	G2304D	probably damaging	Het
Shisa7	T	A	7: 4,833,239 (GRCm39)	R341*	probably null	Het
Slc19a3	T	A	1: 83,000,424 (GRCm39)	M198L	probably benign	Het
Slc26a8	T	A	17: 28,863,753 (GRCm39)	N669Y	possibly damaging	Het
Slco1a7	A	G	6: 141,673,362 (GRCm39)	F392S	probably damaging	Het
Snap91	T	C	9: 86,674,610 (GRCm39)	T534A	possibly damaging	Het
Susd4	A	T	1: 182,715,031 (GRCm39)	Y284F	probably damaging	Het
Tas1r1	A	T	4: 152,116,381 (GRCm39)	Y418N	probably damaging	Het
Tdrd12	A	G	7: 35,187,138 (GRCm39)	I584T	probably damaging	Het
Tmtc3	A	C	10: 100,284,888 (GRCm39)	N582K	probably damaging	Het
Tnfrsf11b	G	A	15: 54,119,578 (GRCm39)		probably benign	Het
Trim30a	A	G	7: 104,060,348 (GRCm39)	V476A	probably damaging	Het
Vmn1r39	C	T	6: 66,782,125 (GRCm39)	M27I	probably benign	Het
Vmn2r59	T	C	7: 41,695,744 (GRCm39)	T223A	probably benign	Het
Vps35l	A	G	7: 118,345,613 (GRCm39)	T49A	possibly damaging	Het
Vwa5a	T	C	9: 38,646,039 (GRCm39)	I469T	probably damaging	Het
Wnt3a	A	C	11: 59,140,828 (GRCm39)	D229E	possibly damaging	Het

Other mutations in Ilf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01585:Ilf2	APN	3	90,391,849 (GRCm39)	missense	probably damaging	1.00
R0193:Ilf2	UTSW	3	90,388,646 (GRCm39)	splice site	probably null
R0746:Ilf2	UTSW	3	90,390,114 (GRCm39)	missense	probably damaging	1.00
R1888:Ilf2	UTSW	3	90,394,767 (GRCm39)	unclassified	probably benign
R4441:Ilf2	UTSW	3	90,394,769 (GRCm39)	missense	probably benign	0.18
R7957:Ilf2	UTSW	3	90,394,777 (GRCm39)	nonsense	probably null
R9001:Ilf2	UTSW	3	90,390,108 (GRCm39)	missense	probably benign	0.07
R9280:Ilf2	UTSW	3	90,394,922 (GRCm39)	missense	unknown
R9492:Ilf2	UTSW	3	90,394,570 (GRCm39)	missense	probably benign	0.00
X0011:Ilf2	UTSW	3	90,394,782 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCCTGAATGTGGCTTACAG -3'
(R):5'- GGATCTTCCTAAAGCCTCCATG -3'

Sequencing Primer
(F):5'- CAGGTATAACACACTTCTCTGGG -3'
(R):5'- TTCGAACCAGAGTCTGAGCTG -3'

Posted On

2015-04-17