Incidental Mutation 'R3913:Adh7'
ID309495
Institutional Source Beutler Lab
Gene Symbol Adh7
Ensembl Gene ENSMUSG00000055301
Gene Namealcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
SynonymsAdh3, Adh-3, Adh-3e, Adh3-e, Adh-3t, Adh3-t, Adh4, Adt-1, IV ADH
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138217760-138233382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138221780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 29 (V29E)
Ref Sequence ENSEMBL: ENSMUSP00000087633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090171]
Predicted Effect probably damaging
Transcript: ENSMUST00000090171
AA Change: V29E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087633
Gene: ENSMUSG00000055301
AA Change: V29E

DomainStartEndE-ValueType
Pfam:ADH_N 34 160 6.6e-27 PFAM
Pfam:ADH_zinc_N 202 337 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199865
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class IV alcohol dehydrogenase 7 mu or sigma subunit, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The enzyme encoded by this gene is inefficient in ethanol oxidation, but is the most active as a retinol dehydrogenase; thus it may participate in the synthesis of retinoic acid, a hormone important for cellular differentiation. The expression of this gene is much more abundant in stomach than liver, thus differing from the other known gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in defective ethanol clearance and reduced metabolism of retinal to retinoic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Adh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Adh7 APN 3 138221734 missense probably benign 0.31
IGL01596:Adh7 APN 3 138226242 missense probably damaging 1.00
IGL01960:Adh7 APN 3 138226282 missense probably damaging 1.00
IGL02792:Adh7 APN 3 138223737 missense probably damaging 1.00
IGL03192:Adh7 APN 3 138227960 missense probably damaging 1.00
R1127:Adh7 UTSW 3 138221729 missense probably benign 0.01
R1539:Adh7 UTSW 3 138223955 missense possibly damaging 0.51
R1612:Adh7 UTSW 3 138228881 missense possibly damaging 0.81
R1779:Adh7 UTSW 3 138223991 missense probably damaging 0.99
R3912:Adh7 UTSW 3 138221780 missense probably damaging 1.00
R5699:Adh7 UTSW 3 138226326 missense probably benign 0.00
R5765:Adh7 UTSW 3 138226329 missense probably benign 0.37
R6383:Adh7 UTSW 3 138228017 missense probably benign 0.09
R6520:Adh7 UTSW 3 138224010 missense probably damaging 1.00
R6883:Adh7 UTSW 3 138224064 missense probably damaging 1.00
R7081:Adh7 UTSW 3 138228845 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGAGTTTATTAAAGACCGTGTGG -3'
(R):5'- CATGATCAGTGGGTAAGTTAGCTG -3'

Sequencing Primer
(F):5'- TTAAAGACCGTGTGGATCCC -3'
(R):5'- TTTAAGAAGCCAACCTCTGAGCTG -3'
Posted On2015-04-17