Incidental Mutation 'R3913:Tyw1'
ID309499
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130259035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 36 (V36D)
Ref Sequence ENSEMBL: ENSMUSP00000047318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026387] [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000125625] [ENSMUST00000139211] [ENSMUST00000147619]
Predicted Effect probably benign
Transcript: ENSMUST00000026387
SMART Domains Protein: ENSMUSP00000026387
Gene: ENSMUSG00000025337

DomainStartEndE-ValueType
Pfam:SBDS 14 101 1.2e-36 PFAM
Pfam:SBDS_C 107 225 2.1e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040213
AA Change: V36D

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: V36D

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044204
AA Change: V36D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: V36D

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100662
AA Change: V36D

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: V36D

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125625
SMART Domains Protein: ENSMUSP00000115494
Gene: ENSMUSG00000025337

DomainStartEndE-ValueType
Pfam:SBDS 3 66 2.1e-25 PFAM
Pfam:SBDS_C 69 173 9.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139211
Predicted Effect possibly damaging
Transcript: ENSMUST00000147619
AA Change: V13D

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: V13D

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201598
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAACATCAATGGGCATCTTTG -3'
(R):5'- CGAGCAAACGAACTGGTTC -3'

Sequencing Primer
(F):5'- AACATCAATGGGCATCTTTGTGTGTG -3'
(R):5'- GCAAACGAACTGGTTCTTCACTGG -3'
Posted On2015-04-17