Incidental Mutation 'R3913:Ints10'
ID309505
Institutional Source Beutler Lab
Gene Symbol Ints10
Ensembl Gene ENSMUSG00000031864
Gene Nameintegrator complex subunit 10
Synonyms4921521J11Rik
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location68793929-68831667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68813620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 478 (S478T)
Ref Sequence ENSEMBL: ENSMUSP00000105871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]
Predicted Effect probably damaging
Transcript: ENSMUST00000034328
AA Change: S478T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070713
AA Change: S478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110241
AA Change: S478T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110242
AA Change: S478T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140309
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Ints10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Ints10 APN 8 68819333 missense probably damaging 1.00
IGL00964:Ints10 APN 8 68811986 missense probably damaging 1.00
IGL02326:Ints10 APN 8 68804833 missense probably damaging 0.99
R0012:Ints10 UTSW 8 68807475 missense probably benign 0.01
R0112:Ints10 UTSW 8 68827302 missense probably damaging 0.99
R1302:Ints10 UTSW 8 68827312 missense probably damaging 1.00
R1462:Ints10 UTSW 8 68807644 splice site probably benign
R1540:Ints10 UTSW 8 68796713 splice site probably benign
R1592:Ints10 UTSW 8 68802903 missense possibly damaging 0.69
R1845:Ints10 UTSW 8 68794671 missense probably damaging 1.00
R2144:Ints10 UTSW 8 68796805 missense probably damaging 1.00
R2323:Ints10 UTSW 8 68819345 missense probably benign 0.09
R3765:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R3910:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3912:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R4050:Ints10 UTSW 8 68827351 missense probably damaging 1.00
R4151:Ints10 UTSW 8 68794598 splice site probably null
R4607:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4608:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4881:Ints10 UTSW 8 68810604 missense probably benign 0.08
R4911:Ints10 UTSW 8 68827312 missense probably damaging 0.98
R5255:Ints10 UTSW 8 68793972 start gained probably benign
R5331:Ints10 UTSW 8 68820820 splice site probably null
R5461:Ints10 UTSW 8 68794041 missense possibly damaging 0.59
R5740:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R5741:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R6128:Ints10 UTSW 8 68822252 critical splice donor site probably null
R6465:Ints10 UTSW 8 68807536 missense probably benign
R6868:Ints10 UTSW 8 68797798 missense probably damaging 1.00
R6983:Ints10 UTSW 8 68794051 missense probably damaging 1.00
R7076:Ints10 UTSW 8 68796751 nonsense probably null
R7216:Ints10 UTSW 8 68822157 missense probably damaging 0.96
X0027:Ints10 UTSW 8 68808474 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCCAGAGATGATCATGAAAGTGC -3'
(R):5'- CTGAGTGGTAAAGTCAAACTCAAG -3'

Sequencing Primer
(F):5'- CAGAGATGATCATGAAAGTGCATTAC -3'
(R):5'- TTGACCTGAAAACCCACTATAGG -3'
Posted On2015-04-17