Mutagenetix > Incidental Mutation

Incidental Mutation 'R3914:Mast4'

309571

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040912-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R3914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102868994-103471005 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 102875829 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1112 (R1112*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

AlphaFold

Q811L6

Predicted Effect

probably null
Transcript: ENSMUST00000099202
AA Change: R1103*

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: R1103*

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167058
AA Change: R1280*

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: R1280*

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000171791
AA Change: R1088*

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: R1088*

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

probably null
Transcript: ENSMUST00000194446
AA Change: R1112*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b2	A	T	3: 89,861,755 (GRCm39)	I266N	probably damaging	Het
AU041133	G	A	10: 81,987,649 (GRCm39)	R434Q	probably damaging	Het
Ccdc174	G	T	6: 91,876,338 (GRCm39)	A392S	possibly damaging	Het
Cdh18	T	C	15: 23,410,771 (GRCm39)	Y419H	probably damaging	Het
Col20a1	A	G	2: 180,640,285 (GRCm39)	K509R	probably benign	Het
Csmd2	A	T	4: 128,215,117 (GRCm39)	D513V	probably benign	Het
Disp1	A	G	1: 182,870,666 (GRCm39)	F585L	probably benign	Het
Entpd7	G	A	19: 43,679,597 (GRCm39)	R50Q	probably benign	Het
Exoc1	G	A	5: 76,691,408 (GRCm39)	S244N	possibly damaging	Het
Fam234b	A	G	6: 135,202,681 (GRCm39)	D345G	probably damaging	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,504,945 (GRCm39)		probably null	Het
Gprc6a	T	A	10: 51,504,371 (GRCm39)	M158L	probably benign	Het
Hdc	T	C	2: 126,444,926 (GRCm39)	T255A	probably damaging	Het
Hps5	T	C	7: 46,432,950 (GRCm39)	T257A	probably damaging	Het
Ice1	A	G	13: 70,754,203 (GRCm39)	C628R	probably benign	Het
Igkv2-137	A	T	6: 67,532,968 (GRCm39)	R44W	probably damaging	Het
Islr2	A	T	9: 58,105,666 (GRCm39)	Y531*	probably null	Het
Mrc2	T	C	11: 105,238,058 (GRCm39)		probably benign	Het
Myo19	G	A	11: 84,785,429 (GRCm39)	R224H	probably damaging	Het
Nup58	A	G	14: 60,469,596 (GRCm39)	M375T	possibly damaging	Het
Phaf1	A	G	8: 105,966,615 (GRCm39)	N121D	probably benign	Het
Phldb2	T	C	16: 45,577,526 (GRCm39)	E1133G	probably damaging	Het
Rabl6	T	C	2: 25,478,718 (GRCm39)	T238A	possibly damaging	Het
Ranbp17	G	A	11: 33,429,189 (GRCm39)	A352V	probably benign	Het
Riok3	A	G	18: 12,281,879 (GRCm39)	I283V	probably benign	Het
Rrm1	A	G	7: 102,106,381 (GRCm39)	Y300C	probably damaging	Het
Shoc1	T	A	4: 59,094,201 (GRCm39)	R174S	possibly damaging	Het
Sipa1l3	T	C	7: 29,099,510 (GRCm39)	D253G	probably benign	Het
Slc22a8	T	A	19: 8,585,550 (GRCm39)	I305N	probably damaging	Het
Slc26a3	A	T	12: 31,503,905 (GRCm39)	E303D	probably benign	Het
Slc32a1	C	T	2: 158,453,152 (GRCm39)		probably benign	Het
Tars3	C	A	7: 65,333,556 (GRCm39)	Q585K	probably benign	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Ubqlnl	A	G	7: 103,798,813 (GRCm39)	V228A	probably benign	Het
Wnt7b	T	A	15: 85,422,059 (GRCm39)	D201V	possibly damaging	Het
Xpot	A	T	10: 121,440,443 (GRCm39)	I596N	possibly damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102,907,275 (GRCm39)	nonsense	probably null
IGL00933:Mast4	APN	13	102,871,874 (GRCm39)	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102,910,744 (GRCm39)	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102,890,576 (GRCm39)	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102,897,523 (GRCm39)	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102,904,401 (GRCm39)	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102,887,020 (GRCm39)	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102,874,123 (GRCm39)	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102,873,749 (GRCm39)	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102,910,781 (GRCm39)	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102,874,482 (GRCm39)	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102,878,545 (GRCm39)	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102,872,004 (GRCm39)	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102,990,331 (GRCm39)	makesense	probably null
IGL02850:Mast4	APN	13	102,890,740 (GRCm39)	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102,872,184 (GRCm39)	missense	probably benign
IGL03064:Mast4	APN	13	102,897,472 (GRCm39)	nonsense	probably null
IGL03124:Mast4	APN	13	102,874,753 (GRCm39)	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102,874,163 (GRCm39)	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102,890,764 (GRCm39)	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102,887,905 (GRCm39)	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102,873,615 (GRCm39)	missense	possibly damaging	0.46
buck	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
doe	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
skinnybones	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102,871,370 (GRCm39)	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102,872,825 (GRCm39)	small insertion	probably benign
FR4340:Mast4	UTSW	13	102,871,365 (GRCm39)	frame shift	probably null
FR4548:Mast4	UTSW	13	102,872,826 (GRCm39)	small insertion	probably benign
FR4976:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
FR4976:Mast4	UTSW	13	102,872,820 (GRCm39)	small insertion	probably benign
NA:Mast4	UTSW	13	102,878,565 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102,878,566 (GRCm39)	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103,470,723 (GRCm39)	start gained	probably benign
R0242:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102,890,669 (GRCm39)	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102,871,781 (GRCm39)	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102,888,068 (GRCm39)	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102,895,252 (GRCm39)	splice site	probably benign
R0744:Mast4	UTSW	13	102,873,895 (GRCm39)	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102,990,408 (GRCm39)	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102,907,292 (GRCm39)	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102,872,004 (GRCm39)	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102,887,086 (GRCm39)	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102,909,027 (GRCm39)	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102,873,431 (GRCm39)	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102,875,771 (GRCm39)	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102,930,625 (GRCm39)	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102,887,917 (GRCm39)	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102,875,354 (GRCm39)	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102,895,601 (GRCm39)	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102,887,054 (GRCm39)	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102,890,713 (GRCm39)	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102,871,983 (GRCm39)	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102,872,259 (GRCm39)	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102,934,715 (GRCm39)	splice site	probably benign
R2370:Mast4	UTSW	13	102,910,695 (GRCm39)	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102,875,147 (GRCm39)	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102,872,939 (GRCm39)	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102,990,434 (GRCm39)	splice site	probably benign
R3434:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102,923,927 (GRCm39)	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R4021:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4022:Mast4	UTSW	13	102,990,377 (GRCm39)	missense	probably damaging	1.00
R4022:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4210:Mast4	UTSW	13	102,875,713 (GRCm39)	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102,910,756 (GRCm39)	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102,873,766 (GRCm39)	nonsense	probably null
R4627:Mast4	UTSW	13	103,470,529 (GRCm39)	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103,470,627 (GRCm39)	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102,910,692 (GRCm39)	critical splice donor site	probably null
R4995:Mast4	UTSW	13	103,042,262 (GRCm39)	intron	probably benign
R5059:Mast4	UTSW	13	102,887,071 (GRCm39)	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102,875,391 (GRCm39)	nonsense	probably null
R5101:Mast4	UTSW	13	102,872,864 (GRCm39)	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102,890,723 (GRCm39)	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102,873,987 (GRCm39)	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102,930,580 (GRCm39)	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102,910,701 (GRCm39)	nonsense	probably null
R5906:Mast4	UTSW	13	102,872,252 (GRCm39)	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102,874,764 (GRCm39)	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102,872,148 (GRCm39)	missense	probably benign
R5987:Mast4	UTSW	13	102,895,242 (GRCm39)	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102,990,391 (GRCm39)	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102,872,717 (GRCm39)	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102,897,890 (GRCm39)	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102,872,493 (GRCm39)	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102,874,004 (GRCm39)	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102,941,222 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,934,586 (GRCm39)	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102,872,482 (GRCm39)	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102,874,223 (GRCm39)	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103,470,508 (GRCm39)	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102,874,986 (GRCm39)	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102,930,511 (GRCm39)	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102,887,932 (GRCm39)	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102,923,934 (GRCm39)	nonsense	probably null
R7697:Mast4	UTSW	13	102,875,711 (GRCm39)	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102,890,596 (GRCm39)	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102,875,783 (GRCm39)	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102,874,184 (GRCm39)	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	103,089,633 (GRCm39)	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102,872,247 (GRCm39)	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102,875,229 (GRCm39)	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102,887,986 (GRCm39)	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102,897,900 (GRCm39)	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102,919,899 (GRCm39)	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102,895,174 (GRCm39)	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102,934,606 (GRCm39)	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103,470,438 (GRCm39)	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102,887,933 (GRCm39)	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102,925,532 (GRCm39)	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102,872,944 (GRCm39)	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102,873,593 (GRCm39)	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102,910,711 (GRCm39)	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF015:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
RF019:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF037:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF039:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF040:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
Z1088:Mast4	UTSW	13	102,875,027 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102,874,968 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCATGTGTGATTCAGCCTG -3'
(R):5'- CACAGAAGTGGCATGCTACC -3'

Sequencing Primer
(F):5'- GTGATTCAGCCTGTTTTCCTAAG -3'
(R):5'- TACCATTTAGCAGGTCGGC -3'

Posted On

2015-04-17