Incidental Mutation 'R3915:1700109H08Rik'
List |< first << previous [record 90 of 32981] next >> last >|
ID309587
Institutional Source Beutler Lab
Gene Symbol 1700109H08Rik
Ensembl Gene ENSMUSG00000008307
Gene NameRIKEN cDNA 1700109H08 gene
Synonyms
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3571566-3584356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3577248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 75 (V75I)
Ref Sequence ENSEMBL: ENSMUSP00000118797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008451] [ENSMUST00000125740] [ENSMUST00000147801]
Predicted Effect probably benign
Transcript: ENSMUST00000008451
AA Change: V75I

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000008451
Gene: ENSMUSG00000008307
AA Change: V75I

DomainStartEndE-ValueType
EFh 68 96 1.56e-3 SMART
EFh 104 132 6.45e1 SMART
EFh 149 177 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125740
AA Change: V34I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117825
Gene: ENSMUSG00000008307
AA Change: V34I

DomainStartEndE-ValueType
Pfam:EF-hand_1 27 55 1e-8 PFAM
Pfam:EF-hand_6 27 62 8.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147801
AA Change: V75I

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118797
Gene: ENSMUSG00000008307
AA Change: V75I

DomainStartEndE-ValueType
Pfam:EF-hand_1 68 96 1.2e-7 PFAM
Pfam:EF-hand_6 68 99 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198134
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in 1700109H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:1700109H08Rik APN 5 3580453 missense probably damaging 1.00
IGL01948:1700109H08Rik APN 5 3577326 missense probably damaging 1.00
IGL02040:1700109H08Rik APN 5 3580405 missense probably damaging 1.00
IGL02558:1700109H08Rik APN 5 3582194 makesense probably null
IGL02719:1700109H08Rik APN 5 3582150 missense probably damaging 1.00
R1831:1700109H08Rik UTSW 5 3577255 missense probably damaging 1.00
R2520:1700109H08Rik UTSW 5 3575773 missense probably damaging 1.00
R4594:1700109H08Rik UTSW 5 3575754 missense probably damaging 1.00
R6197:1700109H08Rik UTSW 5 3580442 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCACTGTATTGAATGACTCTTCTG -3'
(R):5'- ACACCTGATATTGTCACCAACTG -3'

Sequencing Primer
(F):5'- GACTCTTCTGATGTGAACATATAGGG -3'
(R):5'- ACATGAATCTATGTTCCCAGGC -3'
Posted On2015-04-17