Incidental Mutation 'R3915:Eomes'
ID309600
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118481273 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 351 (M351V)
Ref Sequence ENSEMBL: ENSMUSP00000107393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably benign
Transcript: ENSMUST00000035020
AA Change: M351V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: M351V

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111763
AA Change: M351V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: M351V

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150633
AA Change: M284V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446
AA Change: M284V

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212286
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1326:Eomes UTSW 9 118484497 nonsense probably null
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2237:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R4158:Eomes UTSW 9 118478963 missense probably benign
R5274:Eomes UTSW 9 118480529 missense probably damaging 1.00
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
R7115:Eomes UTSW 9 118484489 missense probably benign 0.00
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTGGTGATTGGAATACC -3'
(R):5'- GGATGAGCTGTCCAAGAGAC -3'

Sequencing Primer
(F):5'- TTAAGGAAGGCTGGATGCACCC -3'
(R):5'- GCTGTCCAAGAGACCCCGAC -3'
Posted On2015-04-17