Incidental Mutation 'R3915:Kcnj16'
ID309610
Institutional Source Beutler Lab
Gene Symbol Kcnj16
Ensembl Gene ENSMUSG00000051497
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 16
Synonyms6430410F18Rik, Kir5.1
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110968033-111027968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111025556 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 348 (D348G)
Ref Sequence ENSEMBL: ENSMUSP00000136382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106635] [ENSMUST00000106636] [ENSMUST00000125692] [ENSMUST00000150902] [ENSMUST00000178798] [ENSMUST00000180023]
Predicted Effect probably benign
Transcript: ENSMUST00000106635
AA Change: D348G

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102246
Gene: ENSMUSG00000051497
AA Change: D348G

DomainStartEndE-ValueType
Pfam:IRK 37 357 9.3e-132 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106636
AA Change: D348G

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102247
Gene: ENSMUSG00000051497
AA Change: D348G

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125692
SMART Domains Protein: ENSMUSP00000119921
Gene: ENSMUSG00000051497

DomainStartEndE-ValueType
Pfam:IRK 37 103 3.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150902
SMART Domains Protein: ENSMUSP00000121758
Gene: ENSMUSG00000051497

DomainStartEndE-ValueType
Pfam:IRK 37 66 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178798
AA Change: D348G

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137414
Gene: ENSMUSG00000051497
AA Change: D348G

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180023
AA Change: D348G

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136382
Gene: ENSMUSG00000051497
AA Change: D348G

DomainStartEndE-ValueType
Pfam:IRK 37 368 2e-145 PFAM
low complexity region 371 383 N/A INTRINSIC
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which tends to allow potassium to flow into rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may function in fluid and pH balance regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron response to ammonium chloride withdrawal and carbon dioxide treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Kcnj16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Kcnj16 APN 11 111025208 missense probably benign 0.15
IGL00596:Kcnj16 APN 11 111024523 missense probably damaging 0.99
IGL02152:Kcnj16 APN 11 111025210 missense probably benign 0.01
IGL02637:Kcnj16 APN 11 111025613 missense probably benign 0.13
R0054:Kcnj16 UTSW 11 111024723 missense probably damaging 1.00
R0054:Kcnj16 UTSW 11 111024723 missense probably damaging 1.00
R1256:Kcnj16 UTSW 11 111025436 missense probably damaging 0.99
R1557:Kcnj16 UTSW 11 111025241 missense possibly damaging 0.94
R1919:Kcnj16 UTSW 11 111024953 missense possibly damaging 0.86
R1985:Kcnj16 UTSW 11 111025583 missense probably benign 0.00
R2047:Kcnj16 UTSW 11 111025120 unclassified probably null
R2504:Kcnj16 UTSW 11 111025583 missense probably benign 0.00
R6102:Kcnj16 UTSW 11 111025577 missense probably benign 0.39
R6225:Kcnj16 UTSW 11 111025552 nonsense probably null
R6554:Kcnj16 UTSW 11 111025305 nonsense probably null
R6620:Kcnj16 UTSW 11 111024647 missense probably damaging 1.00
X0021:Kcnj16 UTSW 11 111025127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGATTCCACTGGGACATC -3'
(R):5'- CATCTGGGATTCCATGGAGATCC -3'

Sequencing Primer
(F):5'- TCCCACCAGTCCAGAAGTTC -3'
(R):5'- TCCTATTTAAAGTCAGGAGGGC -3'
Posted On2015-04-17