Incidental Mutation 'R3887:Stag3'
ID309689
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Namestromal antigen 3
SynonymsSA-2, stromalin 3
MMRRC Submission 040799-MU
Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138280240-138312393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138298839 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 550 (I550M)
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000162245]
Predicted Effect probably damaging
Transcript: ENSMUST00000048028
AA Change: I550M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: I550M

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161615
Predicted Effect probably damaging
Transcript: ENSMUST00000162245
AA Change: I550M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: I550M

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138299138 missense probably damaging 1.00
IGL00336:Stag3 APN 5 138297659 missense probably benign 0.42
IGL00514:Stag3 APN 5 138300135 missense probably damaging 1.00
IGL00961:Stag3 APN 5 138298349 missense probably benign 0.01
IGL01923:Stag3 APN 5 138289230 missense probably damaging 1.00
IGL02252:Stag3 APN 5 138302548 missense probably damaging 1.00
IGL02424:Stag3 APN 5 138281985 nonsense probably null
IGL02424:Stag3 APN 5 138291366 missense probably damaging 1.00
IGL02869:Stag3 APN 5 138282693 missense probably damaging 0.96
thor UTSW 5 138301036 critical splice donor site probably null
R0016:Stag3 UTSW 5 138291381 missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R1455:Stag3 UTSW 5 138311735 missense probably benign 0.00
R1512:Stag3 UTSW 5 138297985 missense probably benign 0.32
R1530:Stag3 UTSW 5 138297412 missense probably damaging 0.99
R1608:Stag3 UTSW 5 138298639 intron probably null
R1736:Stag3 UTSW 5 138304509 splice site probably benign
R1969:Stag3 UTSW 5 138300138 missense probably damaging 0.99
R2034:Stag3 UTSW 5 138298001 missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138301266 missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138298284 missense probably damaging 1.00
R2411:Stag3 UTSW 5 138283028 splice site probably benign
R3792:Stag3 UTSW 5 138298349 missense probably benign 0.01
R4255:Stag3 UTSW 5 138290881 missense probably damaging 0.98
R4777:Stag3 UTSW 5 138309199 unclassified probably benign
R4842:Stag3 UTSW 5 138309365 intron probably null
R4854:Stag3 UTSW 5 138296694 splice site probably null
R5045:Stag3 UTSW 5 138304478 missense probably damaging 1.00
R5631:Stag3 UTSW 5 138295877 missense probably damaging 0.96
R5729:Stag3 UTSW 5 138290223 missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138298838 missense probably damaging 0.99
R6004:Stag3 UTSW 5 138289206 missense probably damaging 1.00
R6172:Stag3 UTSW 5 138299843 missense probably benign 0.41
R6503:Stag3 UTSW 5 138304420 missense probably damaging 0.96
R6545:Stag3 UTSW 5 138298352 missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138301499 missense probably damaging 0.98
R6861:Stag3 UTSW 5 138304707 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCTGTTGCTGCAGAAAGACCAG -3'
(R):5'- AAAGATGGAGGGCCCTAACC -3'

Sequencing Primer
(F):5'- CAGAGTGCGTGTCAGTCACATG -3'
(R):5'- GGCCCTAACCCAGAATATAGAGATG -3'
Posted On2015-04-17