Incidental Mutation 'R3887:1110001J03Rik'
List |< first << previous [record 81 of 386652] next >> last >|
ID309691
Institutional Source Beutler Lab
Gene Symbol 1110001J03Rik
Ensembl Gene ENSMUSG00000019689
Gene NameRIKEN cDNA 1110001J03 gene
SynonymsFmc1
MMRRC Submission 040799-MU
Accession Numbers
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38533502-38539449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38539288 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 90 (S90P)
Ref Sequence ENSEMBL: ENSMUSP00000019833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019833]
Predicted Effect probably benign
Transcript: ENSMUST00000019833
AA Change: S90P

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1a C A 9: 65,502,248 G440W probably damaging Het
Ano6 A C 15: 95,894,449 T65P probably benign Het
Arhgap26 G A 18: 39,229,966 probably null Het
Arhgef40 G T 14: 52,003,776 W69L noncoding transcript Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gpr55 T A 1: 85,940,551 probably null Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R898C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mtx1 A G 3: 89,224,125 Y1035C noncoding transcript Het
Mycbp2 A G 14: 103,174,797 V2638A probably damaging Het
Mylk3 A G 8: 85,352,047 I539T possibly damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
RP24-321M14.5 A G 3: 144,749,647 T56A noncoding transcript Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1069* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Zzef1 A G 11: 72,915,409 D156G noncoding transcript Het
Other mutations in 1110001J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03091:1110001J03Rik APN 6 38539235 missense probably damaging 1.00
R4988:1110001J03Rik UTSW 6 38534982 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTGTGAACAGGCTGTCTGAC -3'
(R):5'- GAACAGCAATGAACCCAGTG -3'

Sequencing Primer
(F):5'- AACAGGCTGTCTGACTTTGC -3'
(R):5'- TAATGGGCTGAACCTCTGAACCTG -3'
Posted OnApr 17, 2015