Incidental Mutation 'R3916:Ugcg'
ID309730
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAACAAAAGCCTCTTCCTTGAG -3'
(R):5'- GCCTCATACAGTGTTAAAATTCCCC -3'

Sequencing Primer
(F):5'- TTCCTTGAGGTGCCCAGC -3'
(R):5'- CCAAATAAATAAGTAAGCCCACGATG -3'
Posted On2015-04-17