Incidental Mutation 'R3916:Cant1'
ID309767
Institutional Source Beutler Lab
Gene Symbol Cant1
Ensembl Gene ENSMUSG00000025575
Gene Namecalcium activated nucleotidase 1
Synonyms5830420C20Rik, D11Bwg0554e, SCAN-1, Apy1h, Shapy
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118406289-118419086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118408746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000126919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017620] [ENSMUST00000092378] [ENSMUST00000106287] [ENSMUST00000106288] [ENSMUST00000106289] [ENSMUST00000164927]
Predicted Effect probably damaging
Transcript: ENSMUST00000017620
AA Change: V259A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017620
Gene: ENSMUSG00000025575
AA Change: V259A

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092378
AA Change: V259A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090032
Gene: ENSMUSG00000025575
AA Change: V259A

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106287
AA Change: V259A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101894
Gene: ENSMUSG00000025575
AA Change: V259A

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106288
AA Change: V259A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101895
Gene: ENSMUSG00000025575
AA Change: V259A

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106289
AA Change: V296A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101896
Gene: ENSMUSG00000025575
AA Change: V296A

DomainStartEndE-ValueType
Pfam:Apyrase 115 216 6.3e-39 PFAM
Pfam:Apyrase 244 440 3.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164927
AA Change: V259A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126919
Gene: ENSMUSG00000025575
AA Change: V259A

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium-dependent nucleotidase that preferentially hydrolyzes UDP, GDP, and IDP. The encoded protein has low activity with ADP and ATP and shows no activity with AMP and GMP. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
P4ha2 A G 11: 54,126,248 D441G probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Cant1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Cant1 APN 11 118411062 missense probably benign 0.01
IGL02989:Cant1 APN 11 118411212 missense probably damaging 1.00
R0512:Cant1 UTSW 11 118411265 missense probably benign 0.26
R0535:Cant1 UTSW 11 118411143 missense probably damaging 1.00
R1953:Cant1 UTSW 11 118408783 missense probably damaging 1.00
R2154:Cant1 UTSW 11 118411437 missense probably damaging 1.00
R2187:Cant1 UTSW 11 118408841 nonsense probably null
R4065:Cant1 UTSW 11 118407997 missense probably benign
R4786:Cant1 UTSW 11 118408839 missense possibly damaging 0.68
R4847:Cant1 UTSW 11 118410110 nonsense probably null
R5093:Cant1 UTSW 11 118411212 missense probably damaging 1.00
R5265:Cant1 UTSW 11 118408050 missense probably damaging 1.00
R5281:Cant1 UTSW 11 118408870 missense probably damaging 0.99
R5506:Cant1 UTSW 11 118411442 missense probably benign 0.10
R5614:Cant1 UTSW 11 118408743 missense probably benign
R6705:Cant1 UTSW 11 118407872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTTAGGGCTAGCAAGG -3'
(R):5'- TTCTGAACACAGCTGACAGC -3'

Sequencing Primer
(F):5'- CTGTTAGGGCTAGCAAGGGACAG -3'
(R):5'- CTGACAGCAACACAGGCAGG -3'
Posted On2015-04-17