Incidental Mutation 'R3746:Irf3'
ID309806
Institutional Source Beutler Lab
Gene Symbol Irf3
Ensembl Gene ENSMUSG00000003184
Gene Nameinterferon regulatory factor 3
SynonymsC920001K05Rik, IRF-3
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44997648-45002848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44998873 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 54 (F54S)
Ref Sequence ENSEMBL: ENSMUSP00000146773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003284] [ENSMUST00000003290] [ENSMUST00000085383] [ENSMUST00000107834] [ENSMUST00000207128] [ENSMUST00000207342] [ENSMUST00000207443] [ENSMUST00000207521] [ENSMUST00000207755] [ENSMUST00000209066] [ENSMUST00000211735]
Predicted Effect probably damaging
Transcript: ENSMUST00000003284
AA Change: F54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003284
Gene: ENSMUSG00000003184
AA Change: F54S

DomainStartEndE-ValueType
IRF 1 112 6.92e-50 SMART
IRF-3 195 373 4.87e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003290
SMART Domains Protein: ENSMUSP00000003290
Gene: ENSMUSG00000003190

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 170 197 N/A INTRINSIC
SCOP:d1maz__ 227 243 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085383
SMART Domains Protein: ENSMUSP00000082501
Gene: ENSMUSG00000038406

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 185 224 N/A INTRINSIC
coiled coil region 269 295 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
low complexity region 411 435 N/A INTRINSIC
low complexity region 488 511 N/A INTRINSIC
low complexity region 534 618 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
low complexity region 703 726 N/A INTRINSIC
low complexity region 730 739 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
Blast:IG_like 776 833 6e-6 BLAST
low complexity region 843 873 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
low complexity region 917 937 N/A INTRINSIC
coiled coil region 963 983 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1136 1146 N/A INTRINSIC
Blast:IG_like 1151 1194 2e-16 BLAST
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107834
AA Change: F54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103465
Gene: ENSMUSG00000003184
AA Change: F54S

DomainStartEndE-ValueType
IRF 1 112 6.92e-50 SMART
IRF-3 195 373 4.87e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107835
AA Change: F54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103466
Gene: ENSMUSG00000003184
AA Change: F54S

DomainStartEndE-ValueType
IRF 1 112 6.92e-50 SMART
IRF-3 195 373 4.87e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124069
AA Change: S186P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130610
AA Change: F130S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145728
AA Change: F183S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150613
Predicted Effect probably benign
Transcript: ENSMUST00000207128
Predicted Effect probably benign
Transcript: ENSMUST00000207129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207213
Predicted Effect probably benign
Transcript: ENSMUST00000207342
Predicted Effect probably benign
Transcript: ENSMUST00000207443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207476
Predicted Effect probably damaging
Transcript: ENSMUST00000207521
AA Change: F54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207555
Predicted Effect probably benign
Transcript: ENSMUST00000207755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208906
Predicted Effect probably benign
Transcript: ENSMUST00000208958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209006
Predicted Effect probably damaging
Transcript: ENSMUST00000209066
AA Change: F54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211735
Meta Mutation Damage Score 0.776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice are more susceptible to viral infection and exhibit lower serum interferon levels in response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Irf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Irf3 APN 7 44998796 missense possibly damaging 0.95
IGL01935:Irf3 APN 7 45000770 missense probably benign
IGL02334:Irf3 APN 7 44998710 unclassified probably benign
IGL02428:Irf3 APN 7 44998739 missense probably damaging 1.00
IGL02647:Irf3 APN 7 45000376 missense probably benign 0.01
R0801:Irf3 UTSW 7 45000634 unclassified probably benign
R2128:Irf3 UTSW 7 45001744 missense probably damaging 1.00
R2981:Irf3 UTSW 7 44998700 splice site probably null
R5484:Irf3 UTSW 7 44999958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAGAGCATGGAAACCC -3'
(R):5'- GCCCACTCCTAAAGATTTCCCG -3'

Sequencing Primer
(F):5'- TAGAGCATGGAAACCCCGAAAC -3'
(R):5'- TGCTCTTCCAAAGGTCCAGAG -3'
Posted On2015-04-17