Incidental Mutation 'R3746:Vmn2r76'
ID309807
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86225555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 738 (V738A)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: V738A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: V738A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Selenom A G 11: 3,517,132 E137G probably benign Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCCTTTCCATTGGTGC -3'
(R):5'- ACAATTACTGTAGTACTGGCCTTC -3'

Sequencing Primer
(F):5'- CCATTGGTGCTATGATAGACAGG -3'
(R):5'- CAGGTTCACTCTTCCTAGTAAAAGG -3'
Posted On2015-04-17