Incidental Mutation 'R3747:Ugt1a6a'
ID309833
Institutional Source Beutler Lab
Gene Symbol Ugt1a6a
Ensembl Gene ENSMUSG00000054545
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A6A
SynonymsUgt1a6, UGT1.6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88134809-88218997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88139149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 226 (Y226H)
Ref Sequence ENSEMBL: ENSMUSP00000108760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably damaging
Transcript: ENSMUST00000014263
AA Change: Y226H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545
AA Change: Y226H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113134
AA Change: Y226H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545
AA Change: Y226H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113135
AA Change: Y226H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124
AA Change: Y226H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Ugt1a6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ugt1a6a APN 1 88139050 missense probably damaging 1.00
IGL02029:Ugt1a6a APN 1 88138681 missense probably benign 0.28
IGL02059:Ugt1a6a APN 1 88138681 missense possibly damaging 0.63
IGL02553:Ugt1a6a APN 1 88139089 missense probably benign 0.01
R0164:Ugt1a6a UTSW 1 88139270 missense possibly damaging 0.63
R0609:Ugt1a6a UTSW 1 88138884 missense probably benign 0.00
R1055:Ugt1a6a UTSW 1 88139014 missense probably benign
R1994:Ugt1a6a UTSW 1 88138748 missense probably benign 0.01
R3822:Ugt1a6a UTSW 1 88138529 missense probably benign 0.10
R4084:Ugt1a6a UTSW 1 88139177 missense probably benign 0.37
R4153:Ugt1a6a UTSW 1 88138471 critical splice acceptor site probably null
R4343:Ugt1a6a UTSW 1 88138526 missense probably damaging 0.97
R4495:Ugt1a6a UTSW 1 88139183 missense probably damaging 1.00
R4555:Ugt1a6a UTSW 1 88138627 nonsense probably null
R4600:Ugt1a6a UTSW 1 88138864 missense probably benign 0.00
R4631:Ugt1a6a UTSW 1 88139258 missense probably benign 0.01
R4676:Ugt1a6a UTSW 1 88139285 missense possibly damaging 0.48
R5495:Ugt1a6a UTSW 1 88139024 missense probably benign 0.03
R5903:Ugt1a6a UTSW 1 88215123 missense probably damaging 1.00
R5958:Ugt1a6a UTSW 1 88215788 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GATCCTGGCTGAGTATCTCAAC -3'
(R):5'- ATCAGTCACCCACCTGAGTC -3'

Sequencing Primer
(F):5'- GCTGAGTATCTCAACCTGCC -3'
(R):5'- ACCCACCTGAGTCAGCTTTC -3'
Posted On2015-04-17