Incidental Mutation 'R3747:E2f1'
ID309843
Institutional Source Beutler Lab
Gene Symbol E2f1
Ensembl Gene ENSMUSG00000027490
Gene NameE2F transcription factor 1
SynonymsE2F-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154559407-154569892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 154564022 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 144 (G144R)
Ref Sequence ENSEMBL: ENSMUSP00000099434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000894] [ENSMUST00000103145]
Predicted Effect probably damaging
Transcript: ENSMUST00000000894
AA Change: G99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000894
Gene: ENSMUSG00000027490
AA Change: G99R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:E2F_TDP 77 142 1.1e-25 PFAM
low complexity region 156 173 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103145
AA Change: G144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099434
Gene: ENSMUSG00000027490
AA Change: G144R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
E2F_TDP 122 187 1.63e-30 SMART
Pfam:E2F_CC-MB 201 294 2.2e-37 PFAM
low complexity region 318 340 N/A INTRINSIC
Meta Mutation Damage Score 0.44 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in E2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0666:E2f1 UTSW 2 154560929 missense probably benign 0.01
R0674:E2f1 UTSW 2 154564109 missense probably damaging 1.00
R1796:E2f1 UTSW 2 154560929 missense probably benign 0.02
R3751:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3752:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3753:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3843:E2f1 UTSW 2 154560828 missense probably benign 0.00
R3844:E2f1 UTSW 2 154560828 missense probably benign 0.00
R3968:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3969:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3970:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R4409:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R4700:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R5396:E2f1 UTSW 2 154564448 missense probably benign 0.00
R5666:E2f1 UTSW 2 154569181 intron probably benign
R6368:E2f1 UTSW 2 154564476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTAAGACCTTGGTTTCCCAGC -3'
(R):5'- ACATTGCTAGGGAGACAGGC -3'

Sequencing Primer
(F):5'- GCCACTGCAAGCAATTTGG -3'
(R):5'- CTAGGGAGACAGGCCTGTTG -3'
Posted On2015-04-17