Incidental Mutation 'R3747:Ncoa6'
ID309844
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155411641 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 939 (P939L)
Ref Sequence ENSEMBL: ENSMUSP00000118113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]
Predicted Effect probably benign
Transcript: ENSMUST00000043126
AA Change: P939L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: P939L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109670
AA Change: P939L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: P939L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123293
AA Change: P939L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369
AA Change: P939L

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.4e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
low complexity region 564 573 N/A INTRINSIC
low complexity region 615 630 N/A INTRINSIC
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141928
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0652:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1110:Ncoa6 UTSW 2 155411520 splice site probably benign
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3618:Ncoa6 UTSW 2 155407789 missense possibly damaging 0.95
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 unclassified probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5234:Ncoa6 UTSW 2 155438013 missense probably benign 0.01
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5579:Ncoa6 UTSW 2 155406677 missense probably damaging 1.00
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTTGTAAAGGTGTATATGCAGTGC -3'
(R):5'- GTGACACTGAGTAAGGACACTG -3'

Sequencing Primer
(F):5'- TGCAGTGCAAAGTTTATAATTTTAGC -3'
(R):5'- GGTTTAATGAAATGGCCAGGTTACTC -3'
Posted On2015-04-17