Incidental Mutation 'R3747:Clcn1'
ID309854
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42299915 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 393 (Y393N)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: Y393N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: Y393N

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: Y321N
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: Y321N

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTATGGGAAGCCCTGATAC -3'
(R):5'- TATACCCTTGGGCAAAACTATGC -3'

Sequencing Primer
(F):5'- AAGCCCTGATACTGTGGGTAG -3'
(R):5'- TATGCAAGCTCCAAGTTCGAG -3'
Posted On2015-04-17