Incidental Mutation 'R3747:Adam12'
ID309863
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Namea disintegrin and metallopeptidase domain 12 (meltrin alpha)
SynonymsMltna, ADAM12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133883199-134232146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134172865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000120094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000127524] [ENSMUST00000134504]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067680
AA Change: D36G

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: D36G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127524
AA Change: D5G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120094
Gene: ENSMUSG00000054555
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 4.3e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134504
AA Change: D5G

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123161
Gene: ENSMUSG00000054555
AA Change: D5G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 6.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206313
Meta Mutation Damage Score 0.0372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133909881 missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133919610 missense probably benign 0.00
IGL01482:Adam12 APN 7 133967848 missense probably damaging 1.00
IGL01922:Adam12 APN 7 133937472 nonsense probably null
IGL02397:Adam12 APN 7 133909819 splice site probably benign
IGL03401:Adam12 APN 7 133916463 missense probably damaging 1.00
R0122:Adam12 UTSW 7 134012348 missense probably benign 0.45
R0200:Adam12 UTSW 7 133974416 splice site probably null
R0463:Adam12 UTSW 7 133974416 splice site probably null
R0927:Adam12 UTSW 7 133998230 missense probably damaging 1.00
R1258:Adam12 UTSW 7 133937447 missense probably damaging 1.00
R1440:Adam12 UTSW 7 133931814 missense probably benign 0.03
R1483:Adam12 UTSW 7 133930025 missense probably benign 0.41
R1692:Adam12 UTSW 7 133887944 makesense probably null
R1797:Adam12 UTSW 7 133967861 missense probably benign 0.03
R2134:Adam12 UTSW 7 134012288 nonsense probably null
R2230:Adam12 UTSW 7 133919618 missense probably damaging 1.00
R2350:Adam12 UTSW 7 133919524 missense probably damaging 1.00
R2944:Adam12 UTSW 7 133975507 missense probably null 0.02
R3688:Adam12 UTSW 7 133964796 nonsense probably null
R3749:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3750:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R4028:Adam12 UTSW 7 133929996 missense probably damaging 1.00
R4130:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4131:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4346:Adam12 UTSW 7 133981535 missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133916462 missense possibly damaging 0.64
R4887:Adam12 UTSW 7 134172821 missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133887942 makesense probably null
R5468:Adam12 UTSW 7 133975473 missense probably damaging 1.00
R5486:Adam12 UTSW 7 133907672 missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133931736 missense probably damaging 1.00
R6504:Adam12 UTSW 7 133929984 missense probably damaging 1.00
R6783:Adam12 UTSW 7 133974397 missense probably damaging 1.00
R7117:Adam12 UTSW 7 133916462 missense probably benign 0.00
R7263:Adam12 UTSW 7 133919511 missense possibly damaging 0.68
X0057:Adam12 UTSW 7 134012315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATGTACAGAAAACCAGTTTGG -3'
(R):5'- TGCCTGAACTAATAATCCAACAAGG -3'

Sequencing Primer
(F):5'- AACTTCTGTTATCTCAAAGCTGAGGG -3'
(R):5'- CAGAGAATTTATTCGTTCTTAATGCC -3'
Posted On2015-04-17