Incidental Mutation 'R3747:Cx3cr1'
ID309879
Institutional Source Beutler Lab
Gene Symbol Cx3cr1
Ensembl Gene ENSMUSG00000052336
Gene Namechemokine (C-X3-C motif) receptor 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119901616-120069879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120052066 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 90 (H90R)
Ref Sequence ENSEMBL: ENSMUSP00000150463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064165] [ENSMUST00000177637] [ENSMUST00000215016]
Predicted Effect probably damaging
Transcript: ENSMUST00000064165
AA Change: H90R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063986
Gene: ENSMUSG00000052336
AA Change: H90R

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 8.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177637
AA Change: H90R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336
AA Change: H90R

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215016
AA Change: H90R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Age related retinal degeneration with abnormal subretinal microglial cell accumulation in one homozygous null mice. Other null mice shows impaired monocyte recruitment after vascular injury, kidney ischemia and reperfusion, and bacterial infection of the instestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Cx3cr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Cx3cr1 APN 9 120051437 nonsense probably null
R0507:Cx3cr1 UTSW 9 120051956 missense probably damaging 1.00
R1777:Cx3cr1 UTSW 9 120051593 missense probably damaging 1.00
R2099:Cx3cr1 UTSW 9 120052273 missense probably benign 0.00
R2120:Cx3cr1 UTSW 9 120051683 missense probably damaging 1.00
R3746:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3748:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3939:Cx3cr1 UTSW 9 120051644 missense probably benign
R4629:Cx3cr1 UTSW 9 120051664 missense probably damaging 1.00
R6185:Cx3cr1 UTSW 9 120051378 missense probably benign 0.06
R6244:Cx3cr1 UTSW 9 120051694 missense probably damaging 1.00
R6790:Cx3cr1 UTSW 9 120051767 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCCAGACTAATGGTGAC -3'
(R):5'- AGTATGACGATTCTGCTGAGGC -3'

Sequencing Primer
(F):5'- TGACACCGTGCTGCACTG -3'
(R):5'- GACATTGTGGCCTTTGGAACCATC -3'
Posted On2015-04-17