Incidental Mutation 'R3747:Zdhhc17'
ID309883
Institutional Source Beutler Lab
Gene Symbol Zdhhc17
Ensembl Gene ENSMUSG00000035798
Gene Namezinc finger, DHHC domain containing 17
SynonymsHip14, A230053P19Rik, D130071N24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location110941780-111010140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110944420 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 624 (I624M)
Ref Sequence ENSEMBL: ENSMUSP00000043279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020403] [ENSMUST00000041723]
Predicted Effect probably benign
Transcript: ENSMUST00000020403
SMART Domains Protein: ENSMUSP00000020403
Gene: ENSMUSG00000020186

DomainStartEndE-ValueType
LIM 9 61 3.56e-11 SMART
LIM 118 170 7.39e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041723
AA Change: I624M

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043279
Gene: ENSMUSG00000035798
AA Change: I624M

DomainStartEndE-ValueType
Blast:ANK 57 85 2e-8 BLAST
ANK 89 118 6.71e-2 SMART
ANK 123 152 1.99e-4 SMART
ANK 156 185 1.61e-4 SMART
ANK 189 219 1.9e-1 SMART
ANK 224 253 1.53e-5 SMART
Blast:ANK 257 286 2e-11 BLAST
transmembrane domain 305 323 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 384 403 N/A INTRINSIC
Pfam:zf-DHHC 434 570 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217982
Predicted Effect probably benign
Transcript: ENSMUST00000220247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reminiscent of Huntington disease (decreased body weight, impaired coordination, hyperactivity, increased rearing, decreased prepulse inhibition, increased stereotypic behavior, reduced striatum, and decreased brain weight). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Zdhhc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Zdhhc17 APN 10 110946193 missense probably damaging 1.00
IGL01812:Zdhhc17 APN 10 110948217 missense possibly damaging 0.93
IGL01948:Zdhhc17 APN 10 110946276 missense possibly damaging 0.56
IGL02002:Zdhhc17 APN 10 110967689 missense probably benign
IGL03263:Zdhhc17 APN 10 110961016 missense probably damaging 1.00
R0153:Zdhhc17 UTSW 10 110955094 nonsense probably null
R0375:Zdhhc17 UTSW 10 110982106 nonsense probably null
R0436:Zdhhc17 UTSW 10 110981990 splice site probably null
R1452:Zdhhc17 UTSW 10 110955075 missense probably benign 0.04
R1496:Zdhhc17 UTSW 10 110946210 missense probably damaging 0.99
R1528:Zdhhc17 UTSW 10 110948189 critical splice donor site probably null
R1856:Zdhhc17 UTSW 10 110947293 splice site probably null
R2119:Zdhhc17 UTSW 10 110982048 missense possibly damaging 0.92
R4900:Zdhhc17 UTSW 10 110985958 missense possibly damaging 0.95
R5647:Zdhhc17 UTSW 10 110973833 missense probably damaging 1.00
R5758:Zdhhc17 UTSW 10 110944395 makesense probably null
R6228:Zdhhc17 UTSW 10 110956355 missense probably benign 0.01
R6823:Zdhhc17 UTSW 10 110955111 missense possibly damaging 0.91
R7172:Zdhhc17 UTSW 10 111009948 missense possibly damaging 0.82
Z1088:Zdhhc17 UTSW 10 110945466 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAACAAGGCTGTCGAGTTCAC -3'
(R):5'- CTTTCTTGCAAGCATCCTGAG -3'

Sequencing Primer
(F):5'- CGGTTAGCCCTACATATAGCATG -3'
(R):5'- GCAAGCATCCTGAGTTTTTAAGC -3'
Posted On2015-04-17