Mutagenetix > Incidental Mutation

Incidental Mutation 'R3747:Foxd1'

309890

Institutional Source

Beutler Lab

Gene Symbol

Foxd1

Ensembl Gene

ENSMUSG00000078302

Gene Name

forkhead box D1

Synonyms

Hfh10, BF-2, FREAC4, Hfhbf2

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3747 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98490753-98493213 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 98492424 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 433 (A433P)

Ref Sequence

ENSEMBL: ENSMUSP00000100725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105098]

AlphaFold

Q61345

Predicted Effect

unknown
Transcript: ENSMUST00000105098
AA Change: A433P

SMART Domains

Protein: ENSMUSP00000100725
Gene: ENSMUSG00000078302
AA Change: A433P

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	83	124	N/A	INTRINSIC
FH	128	218	7.63e-61	SMART
low complexity region	231	280	N/A	INTRINSIC
low complexity region	282	323	N/A	INTRINSIC
low complexity region	336	361	N/A	INTRINSIC
low complexity region	378	434	N/A	INTRINSIC

Meta Mutation Damage Score

0.0779

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. Studies of the orthologous mouse protein indicate that it functions in kidney development by promoting nephron progenitor differentiation, and it also functions in the development of the retina and optic chiasm. It may also regulate inflammatory reactions and prevent autoimmunity. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for this targeted mutation die within 24 hours after birth with severe defects in nephrogenesis, and abnormal development of the renal collecting system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 77,036,501 (GRCm39)	E347*	probably null	Het
Abhd18	A	G	3: 40,888,008 (GRCm39)	N284S	probably benign	Het
Adam12	T	C	7: 133,774,594 (GRCm39)	D5G	probably damaging	Het
Adam26b	A	C	8: 43,974,234 (GRCm39)	V256G	probably benign	Het
Aga	T	A	8: 53,970,856 (GRCm39)	I192N	probably benign	Het
Ago1	A	G	4: 126,354,837 (GRCm39)	I125T	probably benign	Het
Alk	A	G	17: 72,218,560 (GRCm39)	S762P	probably damaging	Het
Bckdk	C	A	7: 127,504,590 (GRCm39)	R105S	probably damaging	Het
Cby3	T	C	11: 50,250,501 (GRCm39)	*236R	probably null	Het
Cfhr1	C	A	1: 139,485,372 (GRCm39)		probably null	Het
Clcn1	T	A	6: 42,276,849 (GRCm39)	Y393N	probably damaging	Het
Cx3cr1	T	C	9: 119,881,132 (GRCm39)	H90R	probably damaging	Het
Cyp3a16	T	A	5: 145,378,881 (GRCm39)	K380M	probably damaging	Het
Cyp4v3	G	A	8: 45,768,745 (GRCm39)	R272*	probably null	Het
Dazap1	C	T	10: 80,123,498 (GRCm39)	R391C	possibly damaging	Het
Dgkh	T	A	14: 78,821,885 (GRCm39)	E876V	probably damaging	Het
Dnah8	A	T	17: 31,003,148 (GRCm39)	K3616*	probably null	Het
E2f1	C	G	2: 154,405,942 (GRCm39)	G144R	probably damaging	Het
Fam221a	A	G	6: 49,349,630 (GRCm39)	D2G	probably damaging	Het
Fam43a	C	T	16: 30,420,664 (GRCm39)	T416I	probably benign	Het
Fam90a1a	C	A	8: 22,453,221 (GRCm39)	S192*	probably null	Het
Garin4	T	G	1: 190,896,207 (GRCm39)	Q145H	probably damaging	Het
Gm10152	G	A	7: 144,316,937 (GRCm39)		probably null	Het
Hipk3	T	A	2: 104,271,628 (GRCm39)	R435*	probably null	Het
Hnrnpab	T	A	11: 51,493,473 (GRCm39)	Y245F	probably benign	Het
Islr2	A	T	9: 58,106,925 (GRCm39)	S112T	probably benign	Het
Itgb7	A	T	15: 102,131,212 (GRCm39)	V280D	probably damaging	Het
Kndc1	G	A	7: 139,507,817 (GRCm39)		probably null	Het
Lrba	T	G	3: 86,283,260 (GRCm39)	L1858R	probably damaging	Het
Mroh2b	G	A	15: 4,981,728 (GRCm39)	W1513*	probably null	Het
Nbeal1	A	G	1: 60,234,182 (GRCm39)	D51G	probably damaging	Het
Ncoa6	G	A	2: 155,253,561 (GRCm39)	P939L	probably benign	Het
Ndst3	A	G	3: 123,465,201 (GRCm39)	I257T	probably benign	Het
Nolc1	CAG	CAGAAG	19: 46,069,795 (GRCm39)		probably benign	Het
Nuf2	T	A	1: 169,352,945 (GRCm39)	N20I	probably damaging	Het
Osbpl7	T	C	11: 96,946,879 (GRCm39)	V223A	probably damaging	Het
Pcm1	T	C	8: 41,785,041 (GRCm39)	I2064T	probably benign	Het
Pkd1	A	G	17: 24,810,435 (GRCm39)	R90G	possibly damaging	Het
Pkdrej	T	A	15: 85,705,278 (GRCm39)	K219N	probably damaging	Het
Ppil4	A	T	10: 7,690,457 (GRCm39)	Q370L	probably benign	Het
Pramel18	T	A	4: 101,767,073 (GRCm39)	D107E	possibly damaging	Het
Primpol	A	T	8: 47,052,848 (GRCm39)	D154E	probably benign	Het
Rb1cc1	T	G	1: 6,318,966 (GRCm39)	V778G	possibly damaging	Het
Sgms1	A	T	19: 32,136,994 (GRCm39)	S191T	possibly damaging	Het
Sned1	T	A	1: 93,189,473 (GRCm39)	F303Y	probably damaging	Het
Sp9	T	A	2: 73,104,652 (GRCm39)	M402K	probably damaging	Het
Spon1	T	C	7: 113,365,621 (GRCm39)	L19P	probably damaging	Het
Spon1	T	A	7: 113,616,024 (GRCm39)	V297E	possibly damaging	Het
Tlr5	T	C	1: 182,802,004 (GRCm39)	I436T	probably benign	Het
Tmem63a	G	A	1: 180,790,679 (GRCm39)	D446N	possibly damaging	Het
Tpcn2	T	C	7: 144,809,260 (GRCm39)	H682R	probably damaging	Het
Ugt1a6a	T	C	1: 88,066,871 (GRCm39)	Y226H	probably damaging	Het
Upf1	G	T	8: 70,786,000 (GRCm39)	N975K	possibly damaging	Het
Ush2a	G	A	1: 188,542,489 (GRCm39)	G3352S	probably benign	Het
Vmn1r39	T	C	6: 66,781,854 (GRCm39)	N155D	probably benign	Het
Vwa5b2	A	G	16: 20,417,076 (GRCm39)		probably benign	Het
Yipf4	G	A	17: 74,803,667 (GRCm39)		probably null	Het
Zdhhc17	T	C	10: 110,780,281 (GRCm39)	I624M	probably benign	Het
Zfhx4	G	A	3: 5,308,225 (GRCm39)	E484K	possibly damaging	Het
Zswim4	G	A	8: 84,938,676 (GRCm39)	P1069S	possibly damaging	Het

Other mutations in Foxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1674:Foxd1	UTSW	13	98,491,347 (GRCm39)	missense	unknown
R2328:Foxd1	UTSW	13	98,491,660 (GRCm39)	missense	probably damaging	1.00
R3750:Foxd1	UTSW	13	98,492,424 (GRCm39)	missense	unknown
R5524:Foxd1	UTSW	13	98,492,412 (GRCm39)	missense	unknown
R5846:Foxd1	UTSW	13	98,491,549 (GRCm39)	missense	probably damaging	1.00
R6880:Foxd1	UTSW	13	98,491,225 (GRCm39)	missense	unknown
R8898:Foxd1	UTSW	13	98,491,596 (GRCm39)	missense	probably damaging	1.00
R9103:Foxd1	UTSW	13	98,491,763 (GRCm39)	missense	possibly damaging	0.66
Z1176:Foxd1	UTSW	13	98,492,446 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTCCATCGAGAGCCTCATC -3'
(R):5'- TGGTCCAAGAATCCGAAGCG -3'

Sequencing Primer
(F):5'- CCTCATCGGGCGCACTC -3'
(R):5'- CCGAAGCGGCGAAAATG -3'

Posted On

2015-04-17