Incidental Mutation 'R3747:Dgkh'
ID309892
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Namediacylglycerol kinase, eta
Synonyms5930402B05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78558750-78732776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78584445 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 876 (E876V)
Ref Sequence ENSEMBL: ENSMUSP00000154554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
Predicted Effect probably damaging
Transcript: ENSMUST00000074729
AA Change: E1009V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731
AA Change: E1009V

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226342
AA Change: E1009V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000227537
Predicted Effect probably damaging
Transcript: ENSMUST00000227767
AA Change: E876V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000228362
AA Change: E876V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78609593 missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78587261 splice site probably benign
IGL00787:Dgkh APN 14 78618514 splice site probably benign
IGL01503:Dgkh APN 14 78616270 missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78587576 missense probably benign 0.01
IGL02707:Dgkh APN 14 78585651 missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78589872 critical splice donor site probably null
IGL03058:Dgkh APN 14 78627797 missense probably benign 0.23
IGL03341:Dgkh APN 14 78595491 splice site probably benign
PIT1430001:Dgkh UTSW 14 78581513 missense probably damaging 1.00
PIT4445001:Dgkh UTSW 14 78575942 missense possibly damaging 0.91
R0153:Dgkh UTSW 14 78570129 nonsense probably null
R0730:Dgkh UTSW 14 78584479 missense probably damaging 0.99
R1136:Dgkh UTSW 14 78624889 missense probably damaging 1.00
R1162:Dgkh UTSW 14 78624451 missense probably damaging 1.00
R1689:Dgkh UTSW 14 78618544 missense possibly damaging 0.86
R1771:Dgkh UTSW 14 78609527 missense probably damaging 1.00
R1861:Dgkh UTSW 14 78578792 missense probably benign 0.04
R1916:Dgkh UTSW 14 78595223 missense probably damaging 0.97
R1930:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1931:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1956:Dgkh UTSW 14 78618541 missense probably damaging 1.00
R2007:Dgkh UTSW 14 78603049 missense probably benign 0.09
R4446:Dgkh UTSW 14 78628083 missense probably damaging 1.00
R4475:Dgkh UTSW 14 78589878 missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78624421 missense probably damaging 1.00
R4970:Dgkh UTSW 14 78618637 missense probably damaging 1.00
R5071:Dgkh UTSW 14 78604532 missense probably damaging 1.00
R5652:Dgkh UTSW 14 78627761 missense probably damaging 1.00
R5726:Dgkh UTSW 14 78624902 missense probably benign 0.16
R5773:Dgkh UTSW 14 78595455 missense probably damaging 1.00
R5855:Dgkh UTSW 14 78624504 critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78587627 missense probably damaging 1.00
R6192:Dgkh UTSW 14 78628064 nonsense probably null
R6868:Dgkh UTSW 14 78624853 missense probably damaging 0.99
R6981:Dgkh UTSW 14 78627742 nonsense probably null
R7095:Dgkh UTSW 14 78627784 missense probably benign 0.07
X0022:Dgkh UTSW 14 78595461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCTGTCTTTCGCAG -3'
(R):5'- TGCAACTGATAGAGCATCGGC -3'

Sequencing Primer
(F):5'- AGGGCGGGTCTCTCCAG -3'
(R):5'- GTATGTTCAAGTCCTGGGCTCAAC -3'
Posted On2015-04-17