Incidental Mutation 'R3747:Itgb7'
ID309897
Institutional Source Beutler Lab
Gene Symbol Itgb7
Ensembl Gene ENSMUSG00000001281
Gene Nameintegrin beta 7
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102215995-102231944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102222777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 280 (V280D)
Ref Sequence ENSEMBL: ENSMUSP00000001327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000127014] [ENSMUST00000230652]
Predicted Effect probably damaging
Transcript: ENSMUST00000001327
AA Change: V280D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281
AA Change: V280D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127014
SMART Domains Protein: ENSMUSP00000123227
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PSI 48 85 4.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230652
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Itgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Itgb7 APN 15 102227585 missense probably benign 0.22
IGL01574:Itgb7 APN 15 102227540 missense possibly damaging 0.83
IGL01814:Itgb7 APN 15 102223417 missense possibly damaging 0.78
IGL01875:Itgb7 APN 15 102217995 missense probably damaging 1.00
IGL01996:Itgb7 APN 15 102217977 missense probably damaging 1.00
IGL02320:Itgb7 APN 15 102224337 missense probably benign 0.04
IGL02541:Itgb7 APN 15 102223457 missense probably benign 0.05
IGL02547:Itgb7 APN 15 102218510 missense probably damaging 1.00
R0083:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0108:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0195:Itgb7 UTSW 15 102222183 unclassified probably benign
R1033:Itgb7 UTSW 15 102223554 missense probably damaging 1.00
R1627:Itgb7 UTSW 15 102223476 missense probably damaging 0.97
R1999:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2150:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2331:Itgb7 UTSW 15 102223548 missense probably damaging 1.00
R4758:Itgb7 UTSW 15 102216207 missense probably benign 0.07
R4779:Itgb7 UTSW 15 102224413 missense possibly damaging 0.54
R5134:Itgb7 UTSW 15 102217407 missense probably damaging 1.00
R5158:Itgb7 UTSW 15 102217029 missense probably benign 0.05
R5323:Itgb7 UTSW 15 102231624 intron probably benign
R5416:Itgb7 UTSW 15 102217309 missense probably benign 0.00
R5652:Itgb7 UTSW 15 102216203 missense possibly damaging 0.48
R6089:Itgb7 UTSW 15 102217286 missense probably benign 0.00
R6144:Itgb7 UTSW 15 102223482 missense probably benign 0.45
R6384:Itgb7 UTSW 15 102224451 missense probably benign 0.04
R6475:Itgb7 UTSW 15 102216266 missense probably benign 0.12
R6754:Itgb7 UTSW 15 102216160 makesense probably null
R6857:Itgb7 UTSW 15 102223465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAATGAGGCTCAGATGG -3'
(R):5'- GTTCAGAGACCTTGGAGCAGAG -3'

Sequencing Primer
(F):5'- TGAGGCTCAGATGGGGGAG -3'
(R):5'- ACCACCTGTAATGGGTTCTGAAGC -3'
Posted On2015-04-17