Incidental Mutation 'R3747:Sgms1'
ID309903
Institutional Source Beutler Lab
Gene Symbol Sgms1
Ensembl Gene ENSMUSG00000040451
Gene Namesphingomyelin synthase 1
SynonymsTmem23, SMS1gamma, SMS1alpha2, SMS1, SMS1beta, SMS1alpha1, 9530058O11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32122727-32389714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32159594 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 191 (S191T)
Ref Sequence ENSEMBL: ENSMUSP00000115785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099514] [ENSMUST00000134415] [ENSMUST00000142618] [ENSMUST00000151289] [ENSMUST00000151822] [ENSMUST00000152340]
Predicted Effect probably benign
Transcript: ENSMUST00000099514
AA Change: S191T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097114
Gene: ENSMUSG00000040451
AA Change: S191T

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131768
Predicted Effect possibly damaging
Transcript: ENSMUST00000134415
AA Change: S191T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115785
Gene: ENSMUSG00000040451
AA Change: S191T

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.3e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141655
Predicted Effect probably benign
Transcript: ENSMUST00000142618
AA Change: S191T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117336
Gene: ENSMUSG00000040451
AA Change: S191T

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149107
Predicted Effect probably benign
Transcript: ENSMUST00000151289
AA Change: S191T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123395
Gene: ENSMUSG00000040451
AA Change: S191T

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.5e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
Pfam:PAP2_C 282 355 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151822
Predicted Effect probably benign
Transcript: ENSMUST00000152340
AA Change: S191T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119869
Gene: ENSMUSG00000040451
AA Change: S191T

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.7e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, impaired insulin tolerance, increased insulin sensitivity, decreased insulin secretion, and abnormal pancreatic islet cell mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Sgms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Sgms1 APN 19 32159625 missense probably damaging 1.00
IGL01585:Sgms1 APN 19 32142845 missense probably damaging 1.00
IGL02490:Sgms1 APN 19 32160143 missense probably damaging 0.98
IGL02970:Sgms1 APN 19 32159765 missense probably damaging 0.99
R1051:Sgms1 UTSW 19 32160039 missense probably damaging 1.00
R1871:Sgms1 UTSW 19 32159882 missense probably benign 0.01
R1971:Sgms1 UTSW 19 32159957 missense probably benign 0.05
R2001:Sgms1 UTSW 19 32159683 missense possibly damaging 0.94
R2404:Sgms1 UTSW 19 32159672 nonsense probably null
R2405:Sgms1 UTSW 19 32159672 nonsense probably null
R2408:Sgms1 UTSW 19 32159672 nonsense probably null
R2410:Sgms1 UTSW 19 32159672 nonsense probably null
R4016:Sgms1 UTSW 19 32142792 missense possibly damaging 0.88
R4710:Sgms1 UTSW 19 32160137 missense probably damaging 1.00
R5056:Sgms1 UTSW 19 32159687 missense probably damaging 1.00
R5422:Sgms1 UTSW 19 32159832 missense probably damaging 0.98
R6023:Sgms1 UTSW 19 32124373 missense probably benign 0.12
R6106:Sgms1 UTSW 19 32124425 missense possibly damaging 0.87
R6932:Sgms1 UTSW 19 32142793 missense probably benign 0.02
R7207:Sgms1 UTSW 19 32142747 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTCAATTAGTTCCATGGGTG -3'
(R):5'- TCCCAGTATCCCATGGAGTG -3'

Sequencing Primer
(F):5'- GGGAATTCCTAAGCTTTGATTTCAAC -3'
(R):5'- GAGTGGGGCAAGACTTTCC -3'
Posted On2015-04-17