Incidental Mutation 'R3892:Ptprk'
ID309995
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 040804-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28263621 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 114 (Q114L)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably benign
Transcript: ENSMUST00000166468
AA Change: Q114L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: Q114L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: Q114L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000218359
AA Change: Q114L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219761
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sacs T G 14: 61,204,387 I1294R probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAGTTGTTTGATACCCCTGGC -3'
(R):5'- TCCTGCAGGACCAGTATTTATATC -3'

Sequencing Primer
(F):5'- TGATACCCCTGGCTTATCAATG -3'
(R):5'- GCACAAACCAGAAAAATCTCAGGGG -3'
Posted On2015-04-17