Incidental Mutation 'R3892:Sacs'
ID310005
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 040804-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R3892 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 61204387 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 1294 (I1294R)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: I1294R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: I1294R

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 T A 10: 50,842,193 I1994N probably damaging Het
BC061237 A G 14: 44,501,273 D43G probably benign Het
Bckdhb A C 9: 83,988,810 E124D probably damaging Het
Card6 T C 15: 5,099,296 T873A probably benign Het
Cbs C A 17: 31,616,074 C476F probably benign Het
Cckbr A C 7: 105,426,169 T49P probably benign Het
Cd248 C T 19: 5,069,506 P461S probably damaging Het
Cdh16 T C 8: 104,616,327 Y19C probably damaging Het
Clip2 T C 5: 134,522,993 K92E probably damaging Het
Cnnm2 T A 19: 46,761,793 C7* probably null Het
Ctnnb1 T G 9: 120,950,514 probably benign Het
Def8 T C 8: 123,458,344 probably benign Het
Deup1 A G 9: 15,599,713 Y257H probably damaging Het
Diaph1 C A 18: 37,900,638 probably benign Het
Dmrta1 A T 4: 89,691,594 I264F possibly damaging Het
Dnah12 A G 14: 26,856,616 M491V probably benign Het
Eftud2 A C 11: 102,846,187 I590S probably damaging Het
Ep300 T C 15: 81,619,997 probably benign Het
Fam209 A G 2: 172,472,698 K36E probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Flg A T 3: 93,279,526 Q95L probably benign Het
Gabrr2 A G 4: 33,081,348 Y4C probably damaging Het
Ggcx G A 6: 72,418,372 V149M probably damaging Het
Gm10801 T G 2: 98,663,901 probably null Het
H2-M10.1 T A 17: 36,324,389 Q250L possibly damaging Het
Hecw2 A T 1: 53,926,121 N515K probably benign Het
Hmcn1 A T 1: 150,635,195 D3592E probably damaging Het
Klf5 T A 14: 99,299,073 F27I probably benign Het
Krt1 T A 15: 101,850,412 S106C unknown Het
Lrrc14b T C 13: 74,363,668 S98G probably benign Het
Lrrc7 A G 3: 158,160,696 V1136A probably benign Het
Map3k11 G T 19: 5,702,283 C831F probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Mipep T C 14: 60,808,995 L322P probably damaging Het
Mob1b T A 5: 88,753,202 I156K probably damaging Het
Myd88 T C 9: 119,337,816 D225G possibly damaging Het
Nos1ap T C 1: 170,349,456 Y126C probably damaging Het
Nuak2 G T 1: 132,331,485 A342S possibly damaging Het
Olfr1309 A C 2: 111,983,141 M311R probably benign Het
Olfr58 T G 9: 19,783,715 I194S probably benign Het
Olfr718-ps1 G T 5: 143,137,397 S290R probably benign Het
Pcdhb16 A T 18: 37,479,369 I461F probably benign Het
Pcdhga10 A C 18: 37,749,481 H765P probably benign Het
Plxna4 C A 6: 32,215,654 D791Y probably damaging Het
Pole T G 5: 110,336,439 I320M probably damaging Het
Psg23 G T 7: 18,612,041 T243N probably damaging Het
Ptma-ps1 A G 7: 24,064,118 noncoding transcript Het
Ptprk A T 10: 28,263,621 Q114L probably benign Het
Pum1 T C 4: 130,764,082 L774P probably damaging Het
Rabgef1 A G 5: 130,208,679 probably benign Het
Rasef A G 4: 73,780,397 V9A probably benign Het
Rcbtb1 T A 14: 59,228,355 H382Q possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snrnp48 G A 13: 38,217,389 S204N possibly damaging Het
Sp3 A G 2: 72,979,032 probably benign Het
St8sia6 G A 2: 13,672,524 H161Y probably benign Het
Strip2 A T 6: 29,917,075 probably benign Het
Trank1 T C 9: 111,364,759 V617A probably benign Het
Uvssa T A 5: 33,389,752 S221T probably benign Het
Vmn2r75 A T 7: 86,164,286 L436Q probably null Het
Wdfy4 T C 14: 33,047,280 E2076G probably damaging Het
Zfp407 C T 18: 84,560,352 V879I probably damaging Het
Zmym4 A G 4: 126,904,476 I786T probably benign Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGCATCTTCACAAAGC -3'
(R):5'- GCTTGCTGGAATCTGATTGC -3'

Sequencing Primer
(F):5'- TTCACAAAGCCTACTATCAATGCTG -3'
(R):5'- CTTGCTGGAATCTGATTGCTATAGAG -3'
Posted On2015-04-17