Incidental Mutation 'R0382:Slc9b2'
ID31003
Institutional Source Beutler Lab
Gene Symbol Slc9b2
Ensembl Gene ENSMUSG00000037994
Gene Namesolute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
SynonymsC80638, nha-oc, Nhedc2, NHE10, NHA2
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0382 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135307700-135345387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135318422 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 78 (C78F)
Ref Sequence ENSEMBL: ENSMUSP00000060640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195] [ENSMUST00000149655]
Predicted Effect probably damaging
Transcript: ENSMUST00000051849
AA Change: C78F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: C78F

DomainStartEndE-ValueType
transmembrane domain 83 102 N/A INTRINSIC
Pfam:Na_H_Exchanger 116 515 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126034
Predicted Effect probably benign
Transcript: ENSMUST00000145195
SMART Domains Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149655
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Slc9b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Slc9b2 APN 3 135336395 missense probably benign 0.17
IGL03091:Slc9b2 APN 3 135329030 missense probably damaging 0.97
IGL03203:Slc9b2 APN 3 135326212 missense probably damaging 1.00
IGL03377:Slc9b2 APN 3 135336358 missense probably damaging 1.00
IGL02988:Slc9b2 UTSW 3 135318418 missense probably benign 0.02
R0008:Slc9b2 UTSW 3 135336508 missense possibly damaging 0.72
R0628:Slc9b2 UTSW 3 135323775 splice site probably benign
R1263:Slc9b2 UTSW 3 135336395 missense probably benign 0.17
R1478:Slc9b2 UTSW 3 135326102 missense probably benign 0.45
R1809:Slc9b2 UTSW 3 135317131 missense possibly damaging 0.90
R2060:Slc9b2 UTSW 3 135326266 missense probably damaging 0.99
R2119:Slc9b2 UTSW 3 135328982 splice site probably null
R3196:Slc9b2 UTSW 3 135336529 missense probably benign 0.04
R3805:Slc9b2 UTSW 3 135324588 missense probably damaging 1.00
R4127:Slc9b2 UTSW 3 135329837 missense probably benign 0.00
R4401:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4402:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4622:Slc9b2 UTSW 3 135332518 missense probably damaging 1.00
R6125:Slc9b2 UTSW 3 135330696 splice site probably null
R7081:Slc9b2 UTSW 3 135321937 missense probably benign 0.10
R7166:Slc9b2 UTSW 3 135326178 missense unknown
R7203:Slc9b2 UTSW 3 135330661 missense probably benign 0.04
R7307:Slc9b2 UTSW 3 135318390 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGGCCTGGTTACATAGTTACATCG -3'
(R):5'- CCTGGAGCCTTTCTTACAGGGATTG -3'

Sequencing Primer
(F):5'- TCTTCTTCTAAGTACGAGGTGAC -3'
(R):5'- GTATGAAATTGCCCAGATCCAG -3'
Posted On2013-04-24